Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU030221

Sigma-Aldrich

MISSION® esiRNA

targeting human SATB2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAACCAAGTGCCAGGAGTTTGGGAGATGGTATAAAAAGTACAAGAAGATTAAAGTGGAAAGAGTGGAACGAGAAAACCTTTCAGACTATTGTGTTCTGGGCCAGCGTCCAATGCATTTACCAAATATGAACCAGCTGGCATCCCTGGGGAAAACCAACGAACAGTCTCCTCACAGCCAAATTCACCACAGTACTCCAATCCGAAACCAAGTGCCCGCATTACAGCCCATCATGAGCCCTGGTCTTCTTTCTCCCCAGCTTAGTCCACAACTTGTAAGGCAACAAATAGCCATGGCCCATCTGATAAACCAACAGATTGCCGTTAGCCGGCTCCTGGCTCACCAGCATCCTCAAGCCATCAACCAGCAGTTCCTGAACCATCCACCCATCCCCAGAGCAGTTAAGCCAGAGCCAAC

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

J-Y Li et al.
European review for medical and pharmacological sciences, 23(15), 6394-6403 (2019-08-06)
We aimed to explore the role of microRNA-449b-5p in osteogenic differentiation of bone marrow mesenchymal stem cells (BMSCs) and its mechanism of action. Quantitative Real Time-Polymerase Chain Reaction (qRT-PCR) assay was used to detect the expression levels of microRNA-449b-5p and
Yi-Qing Wang et al.
Cancer research, 79(14), 3542-3556 (2019-03-13)
Accumulating evidence suggests that long noncoding RNA (lncRNA) plays important regulatory roles in cancer biology. However, the involvement of lncRNA in colorectal carcinoma progression remains largely unknown, especially in colorectal carcinoma metastasis. In this study, we investigated the changes in
Jianbing Hao et al.
Cell and tissue research, 366(3), 733-746 (2016-08-10)
Increasing evidence shows that aldosterone and specific microRNAs (miRs) contribute to vascular smooth muscle cell (VSMC) calcification. In this study, we aim to explore the mechanistic links between miR-34b/c and aldosterone in VSMC calcification. VSMC calcification models were established both
Jianfei Tang et al.
Bone, 114, 137-143 (2018-06-18)
Emerging evidence indicates that microRNAs (miRNAs, miRs) play diverse roles in the regulation of biological processes, including osteoblastic differentiation. In this study, we found that miR-383 is a critical regulator of osteoblastic differentiation. We showed that miR-383 was downregulated during

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico