Saltar al contenido
MilliporeSigma

EHU017231

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC22A5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTGCCACTGTTTGCTTACTTCATCCGAGACTGGCGGATGCTGCTGGTGGCGCTGACGATGCCGGGGGTGCTATGCGTGGCACTCTGGTGGTTCATCCCTGAGTCCCCCCGATGGCTCATCTCTCAGGGACGATTTGAAGAGGCAGAGGTGATCATCCGCAAGGCTGCCAAAGCCAATGGGATTGTTGTGCCTTCCACTATCTTTGACCCGAGTGAGTTACAAGACCTAAGTTCCAAGAAGCAGCAGTCCCACAACATTCTGGATCTGCTTCGAACCTGGAATATCCGGATGGTCACCATCATGTCCATAATGCTGTGGATGACCATATCAGTGGGCTATTTTGGGCTTTCGCTTGATACTCCTAACTTGCATGGGGACATCTTTGTGAACTGCTTCCTTTCAGCGATGGTTGAAGTCCCAGCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kei Higuchi et al.
Drug metabolism and pharmacokinetics, 30(2), 182-187 (2015-04-11)
Memantine is clinically used for the treatment of patients with Alzheimer's disease and is highly distributed to the brain. The aim of this study is to characterize memantine transport at the blood-brain barrier (BBB) using hCMEC/D3 cells, a human BBB
Mitsuko Akaihata et al.
Molecular and cellular biochemistry, 459(1-2), 49-59 (2019-05-18)
Glucocorticoid (GC) resistance is associated with poor response to the following chemotherapy in lymphoid malignancies, such as lymphoma and leukemia. However, it remains unclear whether GCs interfere with the cytotoxic effects of anti-cancer drugs on GC-resistant cells. In this study
Jiaojiao Cong et al.
Journal of ethnopharmacology, 252, 112581-112581 (2020-01-23)
The herbs of Aconitum are the essential Traditional Chinese medicine and have played an indispensable role in many Asian countries for thousands of years to treat critical illnesses, and chronic, stubborn diseases. However, Aconitum may induce severe neurotoxicity and even

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico