Saltar al contenido
MilliporeSigma

EHU007521

Sigma-Aldrich

MISSION® esiRNA

targeting human MARCH8

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCATCAGATCTCTGCCATTCCATCCCAGGATGCCATCTCTGCTAGAGTCTACAGAAGTAAGACCAAAGAAAAGGAGAGGGAAGAACAGAATGAGAAGACTTTGGGACATTTCATGAGTCATTCAAGCAACATTTCTAAGGCTGGGAGTCCTCCGTCAGCATCAGCTCCGGCTCCGGTGTCCTCCTTCTCTCGCACTTCTATCACGCCATCCAGCCAGGACATCTGCAGGATCTGCCACTGTGAAGGAGATGATGAGAGCCCCCTGATCACCCCCTGCCACTGCACAGGAAGCCTCCACTTCGTGCACCAGGCCTGCCTGCAGCAGTGGATCAAGAGCTCCGACACGCGCTGCTGCGAGCTCTGCAAGTATGAGTTCATCATGGAGACCAAGCTGAAGCCACTGAGAAAATGGGAGAAGTTGCAGATGACGTCCA

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shanglin Guo et al.
Anatomical record (Hoboken, N.J. : 2007), 302(12), 2271-2278 (2019-08-24)
Tumor necrosis factor-α (TNF-α) is an important inflammatory cytokine that plays a key role in neuronal damage. Elevated expression of TNF-α is associated with numerous neurodegenerative diseases including Alzheimer's Disease and Parkinson's Disease. However, the specific mechanism of the signaling
Shivam Singh et al.
Cancer cell international, 17, 116-116 (2017-12-08)
Herein, for the first time, we report aberrant expression of membrane-associated RING-CH8 (MARCH8) in human esophageal squamous cell carcinoma. MARCH8 is a member of the recently discovered MARCH family of really interesting new genes (RING) E3 ligases. Though initial studies
Sriganesh B Sharma et al.
Molecular and cellular biology, 34(22), 4143-4164 (2014-09-10)
Despite the low prevalence of activating point mutation of RAS or RAF genes, the RAS-extracellular signal-regulated kinase (ERK) pathway is implicated in breast cancer pathogenesis. Indeed, in triple-negative breast cancer (TNBC), there is recurrent genetic alteration of pathway components. Using

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico