Saltar al contenido
MilliporeSigma

EHU003861

Sigma-Aldrich

MISSION® esiRNA

targeting human CDKN1A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACACCACTGGAGGGTGACTTCGCCTGGGAGCGTGTGCGGGGCCTTGGCCTGCCCAAGCTCTACCTTCCCACGGGGCCCCGGCGAGGCCGGGATGAGTTGGGAGGAGGCAGGCGGCCTGGCACCTCACCTGCTCTGCTGCAGGGGACAGCAGAGGAAGACCATGTGGACCTGTCACTGTCTTGTACCCTTGTGCCTCGCTCAGGGGAGCAGGCTGAAGGGTCCCCAGGTGGACCTGGAGACTCTCAGGGTCGAAAACGGCGGCAGACCAGCATGACAGATTTCTACCACTCCAAACGCCGGCTGATCTTCTCCAAGAGGAAGCCCTAATCCGCCCACAGGAAGCCTGCAGTCCTGGAAGCGCGAGGGCCTCAAAGGCCCGCTCTACATCTTCTGCCTTAGTCTCAGTTTGTGTGTCTTAATTATTATTTGTGTTTTAATTTAAACACCTCCTCATGTACATACCCTGGCCGCCCCCTGCCCCCCAGCCTCTGGCATTAGAATTATTTAAACAAAAACTAGGCGGTTGAATGAGAGGTTCCTAAGAGTGCTGGGCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yi Ji et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 40(5), 895-907 (2016-12-13)
The Notch signaling pathway has been implicated in the pericyte phenotype, but its exact roles in hemangioma-derived pericytes (Hem-pericytes) remain ill defined. Hem-pericytes were stimulated by immobilized recombinant Jagged1. The potential mechanisms of Notch-induced Hem-pericytes growth arrest were investigated by
Outhiriaradjou Benard et al.
Molecular cancer research : MCR, 17(7), 1571-1581 (2019-04-11)
Cancer stem cells (CSC) generate and sustain tumors due to tumor-initiating potential, resulting in recurrence or metastasis. We showed that knockout of the cell-cycle inhibitor, p21CIP1, in the PyMT mammary tumor model inhibits metastasis; however the mechanism remained unknown. Here
Hui Zhu et al.
Stem cells (Dayton, Ohio), 32(8), 2098-2110 (2014-04-18)
In mammalian embryos, embryonic stem cells (ESCs) and induced pluripotent cells, a shortened G1 phase is correlated with the pluripotent state. To molecularly define this phase, we compared transcripts from the shortened G1 of human ESCs (hESCs) with those from
Anna E Vilgelm et al.
EBioMedicine, 24, 43-55 (2017-10-17)
Antagonists of MDM2-p53 interaction are emerging anti-cancer drugs utilized in clinical trials for malignancies that rarely mutate p53, including melanoma. We discovered that MDM2-p53 antagonists protect DNA from drug-induced damage in melanoma cells and patient-derived xenografts. Among the tested DNA
Hang Thi Thuy Bui et al.
International journal of medical sciences, 16(11), 1412-1423 (2019-11-02)
Resistance against tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced cell death of cancer cells is a major obstacle in clinical application of TRAIL. Variable response to TRAIL of gastric cancer cells, synergy of TRAIL with bortezomib and potential mechanisms behind the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico