Saltar al contenido
MilliporeSigma

EHU001661

Sigma-Aldrich

MISSION® esiRNA

targeting human CNOT2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCTGGAAGAGCTCCTTATGTTGGAATGGTAACAAAACCAGCAAATGAACAATCCCAGGACTTCTCAATACACAATGAAGATTTTCCAGCATTACCAGGCTCCAGCTATAAAGATCCAACATCAAGTAATGATGACAGTAAATCTAATTTGAATACATCTGGCAAGACAACTTCAAGTACAGATGGACCCAAATTCCCTGGAGATAAAAGTTCAACAACACAAAATAATAACCAGCAGAAAAAAGGGATCCAGGTGTTACCTGATGGTCGGGTTACTAACATTCCTCAAGGGATGGTGACGGACCAATTTGGAATGATTGGCCTGTTAACATTTATCAGGGCAGCAGAGACAGACCCAGGAATGGTACATCTTGCATTAGGAAGTGACTTAACAACATTAGGCCTCAATCTGAACTCTCCTGAAAATCTCTACCCCAAATTTGCGTCACCCTGGGCATCTTCACCTTGTCGACCTCAAGACATAGACTTCCATGTTCCATCTGAGTACTTAACGAACATTCACATTAGGGATAAGCTGGCTGCAATAAAACTTGGCCGATATGGTGAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Eun Jung Sohn et al.
Cancer letters, 412, 88-98 (2017-10-13)
Here the underlying role of CNOT2, a subunit of CCR4-NOT complex, was elucidated in cancer progression. CNOT2 was overexpressed in HIT-T15, ASPC-1, BXPC-3, PC-3, LNCaP, MCF-7 and MDA-MB-231 cell lines, which was confirmed by Tissue array in various human tumor
Eun-Ok Kim et al.
International journal of molecular medicine, 45(2), 324-332 (2020-01-03)
TRAIL is an attractive candidate for anticancer therapy in a variety of tumors since it targets only tumors and not normal tissue. However, a remaining major hurdle is that the majority of tumors exhibit a resistance mechanism against the effects
Kwon Jeong et al.
Oncotarget, 8(28), 46034-46046 (2017-05-26)
Though CNOT2 is involved in regulation of adipogenic differentiation, apoptotic cell death and metastasis, the underlying autophagic mechanism of CNOT2 was unknown until now. Thus, in the present study, the critical role of CNOT2 in autophagy was elucidated in association

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico