Saltar al contenido
MilliporeSigma

EHU001251

Sigma-Aldrich

MISSION® esiRNA

targeting human BTG1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCACTGGTTCCCAGAAAAGCCATGCAAGGGATCGGGTTACCGTTGTATTCGCATCAACCATAAAATGGATCCTCTGATTGGACAGGCAGCACAGCGGATTGGACTGAGCAGTCAGGAGCTGTTCAGGCTTCTCCCAAGTGAACTCACACTCTGGGTTGACCCCTATGAAGTGTCCTACAGAATTGGAGAGGATGGCTCCATCTGTGTGCTGTATGAAGCCTCACCAGCAGGAGGTAGCACTCAAAACAGCACCAACGTGCAAATGGTAGACAGCCGAATCAGCTGTAAGGAGGAACTTCTCTTGGGCAGAACGAGCCCTTCCAAAAACTACAATATGATGACTGTATCAGGTTAAGATATAGTCTGTGGATGGATCATCTGATGATGATGGATAAATTTGATTTTTGCTTTGGGTGGGCTCCTCTTGGGGATGGATTATGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jeong Sook Kim et al.
International journal of molecular sciences, 20(13) (2019-07-22)
Estrogen affects endometrial cellular proliferation by regulating the expression of the c-myc gene. B-cell translocation gene 1 (BTG1), a translocation partner of the c-myc, is a tumor suppressor gene that promotes apoptosis and negatively regulates cellular proliferation and cell-to-cell adhesion.
Peng Yin et al.
Cancer chemotherapy and pharmacology, 81(5), 863-872 (2018-03-15)
Nasopharyngeal carcinoma (NPC) is one of the most commonly diagnosed cancers worldwide with significantly high prevalence in Southern China. Chemoprevention of cancer with alkylating agent compounds could potentially reverse, suppress, or prevent cancer progression. Cisplatin (CIS) is an antineoplastic or
Zhen-Zhen Zhang et al.
American journal of physiology. Endocrinology and metabolism, 316(6), E1050-E1060 (2019-03-06)
Diabetic retinopathy (DR) is a serious diabetic complication caused by both environmental and genetic factors. Molecular mechanisms of DR may lead to the discovery of reliable prognostic indicators. The current study aimed to clarify the mechanism of microRNA-183 (miR-183) in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico