Saltar al contenido
MilliporeSigma

EHU000091

Sigma-Aldrich

MISSION® esiRNA

targeting human DRD1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTCTGATGGAAATGCCACTTCCCTGGCTGAGACCATAGACAACTGTGACTCCAGCCTCAGCAGGACATATGCCATCTCATCCTCTGTAATAAGCTTTTACATCCCTGTGGCCATCATGATTGTCACCTACACCAGGATCTACAGGATTGCTCAGAAACAAATACGGCGCATTGCGGCCTTGGAGAGGGCAGCAGTCCACGCCAAGAATTGCCAGACCACCACAGGTAATGGAAAGCCTGTCGAATGTTCTCAACCGGAAAGTTCTTTTAAGATGTCCTTCAAAAGAGAAACTAAAGTCCTGAAGACTCTGTCGGTGATCATGGGTGTGTTTGTGTGCTGTTGGCTACCTTTCTTCATCTTGAACTGCATTTTGCCCTTCTGTGGGTCTGGGGAGACGCAGCCCTTCTGCATTGATTCCAACACCTTTGACGTGTTTGTGTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shengzhi Liu et al.
Cancer research, 78(14), 3865-3876 (2018-05-18)
While bone is a frequent target of breast cancer-associated metastasis, little is known about the effects of tumor-bone interactions on the efficacy of tumor-suppressing agents. Here we examined the effect of two FDA-approved dopamine modulators, fluphenazine and trifluoperazine, on mammary
Fengmin Li et al.
Endocrinology, 156(6), 2211-2221 (2015-04-01)
Sorting nexin 5 (SNX5) belongs to the SNX family, which is composed of a diverse group of proteins that mediate trafficking of plasma membrane proteins, receptors, and transporters. SNX5 is important in the resensitization of the dopamine D1-like receptor (D1R).
Kazumasa Minami et al.
Scientific reports, 7, 45686-45686 (2017-04-05)
Dopaminergic signaling plays a critical role in the nervous system, but little is known about its potential role in breast cancer and bone metabolism. A screening of ~1,000 biologically active compounds revealed that a selective agonist of dopamine receptor D1

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico