Skip to Content
Merck
All Photos(1)

Key Documents

EMU056601

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Trpc3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCCTTGCAGATCTCTCTTGGAAGGACTGTGAAGGACATATTCAAGTTCATGGTTCTCTTCATTATGGTGTTCCTGGCTTTCATGATTGGCATGTTCATACTTTATTCTTACTACCTTGGGGCCAAAGTAAATCCTGCTTTTACCACGGTTGAAGAAAGTTTCAAGACTTTGTTTTGGTCCATATTTGGACTGTCTGAAGTGACTTCTGTTGTCCTCAAATATGATCACAAATTCATAGAGAATATTGGCTATGTTCTTTATGGGATATATAATGTAACTATGGTGGTCGTTTTACTCAACATGCTAATTGCTATGATTAATAGCTCATACCAAGAGATCGAGGATGACAGTGATGTAGAATGGAAGTTTGCTCGTTCCAAACTTTGGCTCTCCTACTTCGATGATGGAAAAACATTACCTCCACCCTTCAGTCTGGTCCCTAGTCCAAAATCATTTGTTTACTTCATCATGAGGATCACTAACTTTTCCAAATGCAGGAGGAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Pengzhou Hang et al.
International journal of biological sciences, 11(5), 536-545 (2015-04-22)
Brain-derived neurotrophic factor (BDNF) is associated with coronary artery diseases. However, its role and mechanism in myocardial infarction (MI) is not fully understood. Wistar rat and Kunming mouse model of MI were induced by the ligation of left coronary artery.
Yuyang Sun et al.
Journal of cellular physiology, 230(11), 2848-2856 (2015-04-23)
Calcium-activated chloride channel (CaCC) plays an important role in modulating epithelial secretion. It has been suggested that in salivary tissues, sustained fluid secretion is dependent on Ca(2+) influx that activates ion channels such as CaCC to initiate Cl(-) efflux. However

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service