Skip to Content
Merck
All Photos(1)

Key Documents

EHU152211

Sigma-Aldrich

MISSION® esiRNA

targeting human SHARPIN

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGTGCTCTTGGCTGTGCACGCCGCGGTGAGGCCGCTGGGCGCCGGGCCAGACGCCGAGGCACAGCTGCGGAGGCTGCAGCTGAGCGCGGACCCTGAGCGGCCTGGGCGCTTCCGGCTGGAGCTGCTGGGCGCGGGACCTGGGGCGGTTAATTTGGAGTGGCCCCTGGAGTCAGTTTCCTACACCATCCGAGGCCCCACCCAGCACGAGCTACAGCCTCCACCAGGAGGGCCTGGAACCCTCAGCCTGCACTTCCTCAACCCTCAGGAAGCTCAGCGGTGGGCAGTCCTAGTCCGAGGTGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Dhanya Krishnan et al.
Neurobiology of aging, 93, 131-141 (2020-03-14)
Defective immune cell-mediated clearance of amyloid-beta (Aβ) and Aβ-associated inflammatory activation of immune cells are key contributors in pathogenesis of Alzheimer's disease (AD). However, the underlying mechanisms remain elusive. Shank-associated RH domain-interacting protein (SHARPIN) is a critical regulator of inflammatory
Emilia Peuhu et al.
The EMBO journal, 36(2), 165-182 (2016-12-16)
SHARPIN is a widely expressed multifunctional protein implicated in cancer, inflammation, linear ubiquitination and integrin activity inhibition; however, its contribution to epithelial homeostasis remains poorly understood. Here, we examined the role of SHARPIN in mammary gland development, a process strongly
Julia Zinngrebe et al.
The Journal of experimental medicine, 213(12), 2671-2689 (2016-11-05)
The linear ubiquitin chain assembly complex (LUBAC), consisting of SHANK-associated RH-domain-interacting protein (SHARPIN), heme-oxidized IRP2 ubiquitin ligase-1 (HOIL-1), and HOIL-1-interacting protein (HOIP), is a critical regulator of inflammation and immunity. This is highlighted by the fact that patients with perturbed

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service