Skip to Content
Merck
All Photos(1)

Key Documents

EHU113451

Sigma-Aldrich

MISSION® esiRNA

targeting human RAB6A

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCCAGCAAACTACAAAGTGGATTGATGATGTCAGAACAGAAAGAGGAAGTGATGTTATCATCATGCTAGTAGGAAATAAAACAGATCTTGCTGACAAGAGGCAAGTGTCAATTGAGGAGGGAGAGAGGAAAGCCAAAGAGCTGAATGTTATGTTTATTGAAACTAGTGCAAAAGCTGGATACAATGTAAAGCAGCTCTTTCGACGTGTAGCAGCAGCTTTGCCGGGAATGGAAAGCACACAGGACAGAAGCAGAGAAGATATGATTGACATAAAACTGGAAAAGCCTCAGGAGCAACCAGTCAGTGAAGGAGGCTGTTCCTGCTAATCTCCCATGTCATCTTCAACCTTCTTCAGAAGCTCACTGCTTTGGCCCCCTTACTCTTTCATTGACTGCAGTGTGAATATTGGCTTGAACCTTTTCCCTTCAGTAATAACGTATTGCAATTCATCATTGCTGCCTGTCTC

Ensembl | human accession no.

ENSG00000175582

NCBI accession no.

NM_002869

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RAB6A(5870) , RAB6A(5870)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Fang Wang et al.
Journal of cellular biochemistry (2018-11-13)
Previous studies have demonstrated that hypoxia can induce phenotypic modulation of pulmonary smooth muscle cells; however, the mechanisms remain unclear. The present study aimed to investigate the effect of the GTPase Rab6A-mediated phenotypic modulation and other activities of rat pulmonary
Anand Patwardhan et al.
Nature communications, 8, 15835-15835 (2017-06-14)
Exocytic carriers convey neo-synthesized components from the Golgi apparatus to the cell surface. While the release and anterograde movement of Golgi-derived vesicles require the small GTPase RAB6, its effector ELKS promotes the targeting and docking of secretory vesicles to particular
Haili Huang et al.
Cancer letters, 362(1), 15-24 (2015-03-11)
Our previous study demonstrated that microRNA 5100 (miR-5100) is overexpressed in lung cancer tissues; however, the function of miR-5100 remained elusive. In this study, we demonstrate that miR-5100 is highly expressed in a wide variety of lung cancer tissues and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service