Skip to Content
Merck
All Photos(1)

Key Documents

EHU093621

Sigma-Aldrich

MISSION® esiRNA

targeting human IQGAP3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGGCGTCTGCACTACTTCCAGAAGAATGTTAACTCCATTGTGAAGATCCAGGCATTTTTCCGAGCCAGGAAAGCCCAAGATGACTACAGGATATTAGTGCATGCACCCCACCCTCCTCTCAGTGTGGTACGCAGATTTGCCCATCTCTTGAATCAAAGCCAGCAAGACTTCTTGGCTGAGGCAGAGCTGCTGAAGCTCCAGGAAGAGGTAGTTAGGAAGATCCGATCCAATCAGCAGCTGGAGCAGGACCTCAACATCATGGACATCAAGATTGGCCTGCTGGTGAAGAACCGGATCACTCTGCAGGAAGTGGTCTCCCACTGCAAGAAGCTGACCAAGAGGAATAAGGAACAGCTGTCAGATATGATGGTTCTGGACAAGCAGAAGGGTTTAAAGTCGCTGAGCAAAGAGAAACGGCAGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yongjie Shi et al.
Journal of translational medicine, 15(1), 176-176 (2017-08-16)
Hepatocellular carcinoma (HCC) is one of the most lethal cancers worldwide owing to its high rates of metastasis and recurrence. The oncogene IQ motif-containing GTPase activating protein 3 (IQGAP3) is ubiquitously overexpressed in several human cancers, including liver, ovary, lung
Naohide Oue et al.
Pathobiology : journal of immunopathology, molecular and cellular biology, 85(3), 192-200 (2017-11-14)
Spheroid colony formation is a useful method of cancer stem cell (CSC) characterization. We previously showed that the IQ motif containing the GTPase-activating protein 3 gene (IQGAP3) is upregulated in spheroid body-forming gastric cancer (GC) cells compared with parental cells.
Chase J Morgan et al.
Scientific reports, 9(1), 11057-11057 (2019-08-01)
The Ras family of small GTPases modulates numerous essential processes. Activating Ras mutations result in hyper-activation of selected signaling cascades, which leads to human diseases. The high frequency of Ras mutations in human malignant neoplasms has led to Ras being

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service