Skip to Content
Merck
All Photos(1)

Key Documents

EHU076641

Sigma-Aldrich

MISSION® esiRNA

targeting human JARID2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTTTTGCAATCAGCATTTGGATCTCAGAATGAGCAAGGAAAGACCCAAGAGGAATATCATTCAGAAGAAATACGATGACAGTGATGGGATTCCGTGGTCAGAAGAACGGGTGGTACGTAAAGTCCTTTATTTGTCTCTGAAGGAGTTCAAGAATTCCCAGAAGAGGCAGCATGCGGAAGGCATTGCTGGGAGCCTGAAAACTGTGAATGGGCTCCTTGGTAATGACCAGTCTAAGGGATTAGGACCAGCATCAGAACAGTCAGAGAATGAAAAGGACGATGCATCCCAAGTGTCCTCCACTAGCAACGATGTTAGTTCTTCAGATTTTGAAGAAGGGCCGTCGAGGAAAAGGCCCAGGCTGCAAGCACAAAGGAAGTTTGCTCAGTCTCAGCCGAATAGTCCCAGCACAACTCCAGTAAAGATAGTGGAGCCATTGCTACCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Diaa Al-Raawi et al.
The EMBO journal, 38(3) (2018-12-24)
Polycomb repressive complex-2 (PRC2) is a group of proteins that play an important role during development and in cell differentiation. PRC2 is a histone-modifying complex that catalyses methylation of lysine 27 of histone H3 (H3K27me3) at differentiation genes leading to
Dandan Liang et al.
International journal of cardiology, 201, 38-48 (2015-08-25)
In mammals, the heart grows by hypertrophy but not proliferation of cardiomyocytes after birth. The paucity of cardiomyocyte proliferation limits cardiac regeneration in a variety of heart diseases. To explore the efficient strategies that drive cardiomyocyte proliferation, we employed in
Chang-Liang Su et al.
International journal of hematology, 102(1), 76-85 (2015-05-06)
It has recently been shown that JARID2 contributes to the malignant character of solid tumors, such as epithelial-mesenchymal transition in lung and colon cancer cell lines, but its role in leukemia progression is unexplored. In this study, we explored the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service