Skip to Content
Merck
All Photos(1)

Key Documents

EHU062331

Sigma-Aldrich

MISSION® esiRNA

targeting human TRAF3IP2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGAAGAATTGCGGAAAGTCTTTATCACTTATTCGATGGACACAGCTATGGAGGTGGTGAAATTCGTGAACTTTTTGTTGGTAAATGGCTTCCAAACTGCAATTGACATATTTGAGGATAGAATCCGAGGCATTGATATCATTAAATGGATGGAGCGCTACCTTAGGGATAAGACCGTGATGATAATCGTAGCAATCAGCCCCAAATACAAACAGGACGTGGAAGGCGCTGAGTCGCAGCTGGACGAGGATGAGCATGGCTTACATACTAAGTACATTCATCGAATGATGCAGATTGAGTTCATAAAACAAGGAAGCATGAATTTCAGATTCATCCCTGTGCTCTTCCCAAATGCTAAGAAGGAGCATGTGCCCACCTGGCTTCAGAACACTCATGTCTACAGCTGGCCCAAGAAT

Ensembl | human accession no.

ENSG00000056972

NCBI accession no.

NM_147686

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TRAF3IP2(10758) , TRAF3IP2(10758)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hongxue Sun et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 48(2), 528-539 (2018-07-19)
This study investigated the role of the microRNA miR-298 and its target Act1 in ischemic stroke. Cell viability was assessed with the 3-(4,5-dimethythiazol-2- yl)-2,5-diphenyl tetrazolium bromide assay. Apoptotic cells were detected by flow cytometry, and mRNA and protein expression were
Nitin A Das et al.
Journal of molecular and cellular cardiology, 121, 107-123 (2018-07-10)
Persistent inflammation promotes development and progression of heart failure (HF). TWEAK (TNF-Related WEAK Inducer Of Apoptosis), a NF-κB- and/or AP-1-responsive proinflammatory cytokine that signals via TWEAK receptor (TWEAKR), is expressed at high levels in human and preclinical models of HF.
Hyo Jeong Kim et al.
Biochemical and biophysical research communications, 524(4), 1044-1050 (2020-02-19)
Bone homeostasis is maintained by concerted actions of bone-forming osteoblasts and bone-resorbing osteoclasts. A wide range of evidence indicates that a proinflammatory cytokine IL-17 promotes osteoclastogenesis. However, the role of IL-17 in osteoblasts is less well-understood. In the current study

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service