Skip to Content
Merck
All Photos(1)

Key Documents

EHU048791

Sigma-Aldrich

MISSION® esiRNA

targeting human GCLC

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGCTTCCAAGTCCCTCTTCTTTCCAGATGAAGCAATAAACAAGCACCCTCGCTTCAGTACCTTAACAAGAAATATCCGACATAGGAGAGGAGAAAAGGTTGTCATCAATGTACCAATATTTAAGGACAAGAATACACCATCTCCATTTATAGAAACATTTACTGAGGATGATGAAGCTTCAAGGGCTTCTAAGCCGGATCATATTTACATGGATGCCATGGGATTTGGAATGGGCAATTGCTGTCTCCAGGTGACATTCCAAGCCTGCAGTATATCTGAGGCCAGATACCTTTATGATCAGTTGGCTACTATCTGTCCAATTGTTATGGCTTTGAGTGCTGCATCTCCCTTTTACCGAGGCTATGTGTCAGACATTGATTGTCGCTGGGGAGTGATTTCTGCATCTGTAGATGATAGAACTCGGGAGGAGCGAGGACTGGAGCCATTGAAGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Preeti Kanikarla-Marie et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(6), 2160-2170 (2015-11-26)
Type 1 diabetic (T1D) patients have a higher incidence of liver disease. T1D patients frequently experience elevated plasma ketone levels along with hyperglycemia. However, no study has examined whether hyperketonemia per se has any role in excess liver damage in
Dulani Wimalachandra et al.
Biochimica et biophysica acta, 1863(1), 71-80 (2017-10-21)
Endometriosis is a disease characterized by regurgitated lesions which are invasive and migratory, embedding at ectopic, extra-uterine locations. Extracellular glucosylceramides (GlcCers), bioactive sphingolipids potentiating signals for cell migration, are found in elevated levels in endometriosis; however underlying mechanisms that result
Arunkumar E Achari et al.
Archives of biochemistry and biophysics, 630, 54-65 (2017-08-02)
Diabetic patients have lower blood levels of l-cysteine (LC) and glutathione (GSH). This study examined the hypothesis that LC supplementation positively up regulates the effects of insulin on GSH and glucose metabolism in 3T3-L1 adipocyte model. 3T3L1 adipocytes were treated
Xiaoxiao Yang et al.
The Journal of biological chemistry, 290(36), 21788-21799 (2015-07-19)
The glutathione (GSH)-dependent antioxidant system has been demonstrated to inhibit atherosclerosis. Macrophage CD36 uptakes oxidized low density lipoprotein (oxLDL) thereby facilitating foam cell formation and development of atherosclerosis. It remains unknown if GSH can influence macrophage CD36 expression and cellular

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service