Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU024721

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Wnt1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCGTTCTGCACGAGTGTCTATGAGGTGCCGCGCCTCCGGGAACGGGAACGCTCTCTTCCAGTTCTCAGACACACTCACTGGTCCTGATGTTTGCCCACCCTACCGCGTCCAGCCACAGTCCCAGGGTTCATAGCGATCCATCTCTCCCACCTCCTACCTGGGGACTCCTGAAACCACTTGCCTGAGTCGGCTCGAACCCTTTTGCCATCCTGAGGGCCCTGACCCAGCCTACCTCCCTCCCTCTTTGAGGGAGACTCCTTTTGCACTGCCCCCCAATTTGGCCAGAGGGTGAGAGAAAGATTCTTCTTCTGGGGTGGGGGTGGGGAGGTCAACTCTTGAAGGTGTTGCGGTTCCTGATGTATTTTGCGCTGTGACCTCTTTGGGTATTATCACCTTTCCTTGTCTCTCAGGTCCCTATAGGTCCCTTGAGTTCTCTAACCAGCACCTCTGGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Megan M Weivoda et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 31(1), 76-85 (2015-06-26)
Osteoblast-mediated bone formation is coupled to osteoclast-mediated bone resorption. These processes become uncoupled with age, leading to increased risk for debilitating fractures. Therefore, understanding how osteoblasts are recruited to sites of resorption is vital to treating age-related bone loss. Osteoclasts
Jian Cao et al.
Prostaglandins & other lipid mediators, 116-117, 76-86 (2015-02-14)
Myocardial infarction (MI) is complicated by ventricular fibrosis and associated diastolic and systolic failure. Emerging studies implicate Wnt1 signaling in the formation of new blood vessels. Epoxyeicosatrienoic acids (EETs)-mediated up-regulation of heme oxygenase-1 (HO-1) protects against the detrimental consequences of
Han Yan et al.
Molecular carcinogenesis, 53(12), 960-969 (2013-07-19)
The epithelial-mesenchymal transition (EMT) and acquisition of cancer stem cells (CSCs)-like properties are essential steps in the metastasis and postsurgical recurrence of hepatocellular carcinomas (HCCs). The molecular mechanisms involved, however, remain obscure. As determined by an miRNA microarray analysis, there

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico