Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU008841

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nr1h2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAACGATCTTTCTCCGACCAGCCCAAAGTCACGCCCTGGCCCCTGGGTGCAGACCCTCAGTCCCGAGATGCCCGTCAGCAACGCTTTGCCCACTTCACCGAGCTAGCCATCATCTCGGTCCAGGAGATTGTGGACTTTGCCAAGCAGGTGCCAGGGTTCTTGCAGTTGGGCCGGGAGGACCAGATCGCCCTCCTGAAGGCGTCCACCATTGAGATCATGTTGCTAGAAACAGCCAGACGCTACAACCACGAGACAGAATGCATCACGTTCCTGAAGGACTTCACCTACAGCAAGGACGACTTCCACCGTGCAGGCTTGCAGGTGGAATTCATCAATCCCATCTTCGAGTTCTCGCGGGCCATGCGGCGGCTGGGCCTGGACGATGCAGAGTATGCCTTGCTTATCGCCATCAACA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jasmin R Agarwal et al.
Molecular cancer therapeutics, 13(7), 1873-1881 (2014-05-09)
The Hedgehog (Hh) signaling pathway is aberrantly activated in a wide variety of human cancers, and recent clinical studies have demonstrated that pathway inhibitors are effective in advanced basal cell carcinoma (BCC). The majority of these agents have been designed
Mengyang Liu et al.
The Journal of biological chemistry, 290(23), 14418-14429 (2015-04-29)
Cholesteryl ester transfer protein (CETP) transfers cholesteryl esters from high density lipoprotein to triglyceride-rich lipoproteins. CETP expression can be transcriptionally activated by liver X receptor (LXR). Etoposide and teniposide are DNA topoisomerase II (Topo II) inhibitors. Etoposide has been reported
Limei Zhong et al.
Molecular immunology, 60(1), 32-43 (2014-04-22)
Liver X receptors (LXRs) are nuclear receptors that play an essential role in lipid and cholesterol metabolism. Emerging studies indicate a potential function for LXRs in regulating dendritic cell (DC)-dependent immune responses; however, the role of LXRs in DC differentiation

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico