Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU150481

Sigma-Aldrich

MISSION® esiRNA

targeting human EIF4EBP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGGAGTGTCGGAACTCACCTGTGACCAAAACACCCCCAAGGGATCTGCCCACCATTCCGGGGGTCACCAGCCCTTCCAGTGATGAGCCCCCCATGGAAGCCAGCCAGAGCCACCTGCGCAATAGCCCAGAAGATAAGCGGGCGGGCGGTGAAGAGTCACAGTTTGAGATGGACATTTAAAGCACCAGCCATCGTGTGGAGCACTACCAAGGGGCCCCTCAGGGCCTTCCTGGGAGGAGTCCCACCAGCCAGGCCTTATGAAAGTGATCATACTGGGCAGGCGTTGGCGTGGGGTCGGACACCCCAGCCCTTTCTCCCTCACTCAGGGCACCTGCCCCCTCCTCTTCGTGAACACCAGCAGATACCTCCTTGTGCCTCCACTGATGCAGGAGCTGCCACCCCAAGGGGAGTGACCCCTGCCAGCACACCCTGCAGCCAAGGGCCAGGAAGTGGACAAGAACGAACCCTTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Stabilization of 4E-BP1 by PI3K kinase and its involvement in CHK2 phosphorylation in the cellular response to radiation.
Zi-Jian Yu et al.
International journal of medical sciences, 14(5), 452-461 (2017-05-26)
Jin Young Sung et al.
Experimental gerontology, 109, 51-58 (2017-08-12)
Cellular senescence is related to aging and extremely stable proliferative arrest with active metabolism. Senescent cells can activate mammalian target of rapamycin (mTOR) pathway, which plays a crucial role in the regulation of cell metabolism, cellular growth, and autophagy in
Thomas Graillon et al.
Oncotarget, 8(33), 55361-55373 (2017-09-15)
Pasireotide is a somatostatin analog (SSA) that targets somatostatin receptor subtype 1 (SST1), SST2, SST3, and SST5 with a high affinity. Pasireotide has a better antisecretory effect in acromegaly, Cushing's disease, and neuroendocrine tumors than octreotide. In this study, we
Yuan-Chin Lee et al.
Cancer letters, 432, 191-204 (2018-06-19)
The present study aimed to investigate the pathway related to MCL1 expression in ABT-263-treated human leukemia U937 cells. ABT-263 upregulated MCL1 protein expression but did not affect its mRNA level and protein stability. Notably, ABT-263 increased 4EBP1 mRNA decay and thus
Lianhe Zheng et al.
Molecules and cells, 37(2), 118-125 (2014-03-07)
Osteosarcoma is the most common primary malignant bone tumor with a very poor prognosis. Treating osteosarcoma remains a challenge due to its high transitivity. Tenascin-C, with large molecular weight variants including different combinations of its alternative spliced FNIII repeats, is

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico