Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU119551

Sigma-Aldrich

MISSION® esiRNA

targeting human SOCS3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTCAGCTCCAAGAGCGAGTACCAGCTGGTGGTGAACGCAGTGCGCAAGCTGCAGGAGAGCGGCTTCTACTGGAGCGCAGTGACCGGCGGCGAGGCGAACCTGCTGCTCAGTGCCGAGCCCGCCGGCACCTTTCTGATCCGCGACAGCTCGGACCAGCGCCACTTCTTCACGCTCAGCGTCAAGACCCAGTCTGGGACCAAGAACCTGCGCATCCAGTGTGAGGGGGGCAGCTTCTCTCTGCAGAGCGATCCCCGGAGCACGCAGCCCGTGCCCCGCTTCGACTGCGTGCTCAAGCTGGTGCACCACTACATGCCGCCCCCTGGAGCCCCCTCCTTCCCCTCGCCACCTACTGAACCCTCCTCCGAGGTGCCCGAGCAGCCGTCTGCCCAGCCACTCCCTGGGAGTCCCCCCAGAAGAGCCTATTACATCTACTCCGGGGGCGAGAAGATCCCCCTGGTGTTGAGCCGGCCCCTCTCCTCCAACGTGGCCACTCTTCAGCATCTCTGTCGGAAGACCGT

Ensembl | human accession no.

ENSG00000184557

NCBI accession no.

NM_003955

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SOCS3(9021) , SOCS3(9021)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ranu Surolia et al.
American journal of physiology. Lung cellular and molecular physiology, 311(5), L928-L940 (2016-11-04)
Pulmonary infections with nontuberculous mycobacteria (P-NTM), such as by Mycobacterium avium complex (M. avium), are increasingly found in the elderly, but the underlying mechanisms are unclear. Recent studies suggest that adaptive immunity is necessary, but not sufficient, for host defense
Naotoshi Iwahara et al.
Journal of Alzheimer's disease : JAD, 55(3), 1235-1247 (2016-11-05)
In response to changes of the central nervous system environment, microglia are capable of acquiring diverse phenotypes for cytotoxic or immune regulation and resolution of injury. Alzheimer's disease (AD) pathology also induces several microglial activations, resulting in production of pro-inflammatory
Mandy Boontanrart et al.
Journal of neuroimmunology, 292, 126-136 (2016-03-06)
Microglia become activated immune cells during infection or disease in the central nervous system (CNS). However, the mechanisms that downregulate activated microglia to prevent immune-mediated damage are not completely understood. Vitamin D3 has been suggested to have immunomodulatory affects, and
Rak-Kyun Seong et al.
Pathogens (Basel, Switzerland), 9(3) (2020-03-04)
Zika virus (ZIKV) is a mosquito-borne flavivirus that has emerged and caused global outbreaks since 2007. Although ZIKV proteins have been shown to suppress early anti-viral innate immune responses, little is known about the exact mechanisms. This study demonstrates that
Yan Zhang et al.
Journal of neuroinflammation, 14(1), 211-211 (2017-11-04)
Morphine tolerance is a clinical challenge, and its pathogenesis is closely related to the neuroinflammation mediated by Toll-like receptor 4 (TLR4). In Chinese pain clinic, lidocaine is combined with morphine to treat chronic pain. We found that lidocaine sufficiently inhibited
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico