Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU092591

Sigma-Aldrich

MISSION® esiRNA

targeting human ATF3 (1)

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTTTCTCAGATCTGGTTTCTAAGAGTTTTGGGGGGCGGGGCTGTCACCACGTGCAGTATCTCAAGATATTCAGGTGGCCAGAAGAGCTTGTCAGCAAGAGGAGGACAGAATTCTCCCAGCGTTAACACAAAATCCATGGGCAGTATGATGGCAGGTCCTCTGTTGCAAACTCAGTTCCAAAGTCACAGGAAGAAAGCAGAAAGTTCAACTTCCAAAGGGTTAGGACTCTCCACTCAATGTCTTAGGTCAGGAGTTGTGTCTAGGCTGGAAGAGCCAAAGAATATTCCATTTTCCTTTCCTTGTGGTTGAAAACCACAGTCAGTGGAGAGATGTTTGGAAACCACAGTCAGTGGAGCCTGGGTGGTACCCAGGCTTTAGCATTATTGGATGTCAATAGCA

Ensembl | human accession no.

ENSG00000162772

NCBI accession no.

NM_001040619

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ATF3(467) , ATF3(467)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chun-Chao Chen et al.
European journal of pharmacology, 859, 172542-172542 (2019-07-19)
Nicorandil is an adenosine triphosphate-sensitive potassium channel opener with additional antioxidant properties. Doxorubicin (DOX) is an anticancer drug that exerts oxidation-mediated adverse cardiovascular effects. This study examined the effects of nicorandil on DOX-induced cytotoxicity in human umbilical vein endothelial cells
Shunyan Weng et al.
BMC gastroenterology, 16, 25-25 (2016-02-27)
Hepatocellular carcinoma (HCC) is one of most common and aggressive human malignancies in the world, especially, in eastern Asia, and its mortality is very high at any phase. We want to investigate mechanism of niclosamide inducing cell apoptosis in HCC.
Siqi Ma et al.
International journal of molecular medicine, 35(6), 1561-1573 (2015-04-16)
Glioblastomas are highly malignant gliomas that are extremely invasive with high rates of recurrence and mortality. It has been reported that activating transcription factor 3 (ATF3) is expressed in elevated levels in multiple malignant tumors. The purpose of this study
Liugen Gu et al.
Pathology, research and practice, 214(6), 862-870 (2018-05-03)
Intestinal epithelial cell (IEC) apoptosis plays a vital role in the pathogenesis of Crohn's disease (CD), which is an inflammatory bowel disease (IBD). Activating transcription factor 3 (ATF3) modulates apoptosis under stress via regulating the p53 pathway. However, the expression
Genaro Hernandez et al.
Science translational medicine, 12(525) (2020-01-10)
The exocrine pancreas expresses the highest concentrations of fibroblast growth factor 21 (FGF21) in the body, where it maintains acinar cell proteostasis. Here, we showed in both mice and humans that acute and chronic pancreatitis is associated with a loss
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico