Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU082441

Sigma-Aldrich

MISSION® esiRNA

targeting human DAB2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGGACTTTGAGTGCCTTTGCCAGTTATTTCAACAGCAAGGTTGGCATTCCTCAGGAGAATGCAGACCATGATGACTTTGATGCTAATCAACTATTGAACAAGATCAATGAACCACCAAAGCCAGCTCCCAGACAAGTTTCCCTGCCAGTTACCAAATCTACTGACAATGCATTTGAGAACCCTTTCTTTAAAGATTCTTTTGGTTCATCACAAGCCTCTGTGGCTTCTTCTCAACCTGTATCTTCTGAGATGTATAGGGATCCATTTGGAAATCCTTTTGCCTAAATTCTGAACTTGGTCTGCAGACCATCCAGAGGAATAAAAAGGTTGGCCTTAGTAGTCAAAAACAAAGCTGATAGCCAGACACGTTCTGATTTCTGCCCTTGTTCCAGCTTTGACGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yuan Cheng et al.
Journal of experimental & clinical cancer research : CR, 35, 11-11 (2016-01-16)
MicroRNA-106b (miR-106b) was recently identified as an oncogene participating in cancer progression. Transforming growth factor β1(TGF-β1) is an indispensable cytokine regulating the local microenvironment, thereby promoting cervical cancer progression. However, the roles of miR-106b in cervical carcinoma progression and TGF-β1-involvement
Yoshitaka Itami et al.
Diagnostics (Basel, Switzerland), 10(1) (2020-01-24)
Disabled homolog-2 (DAB2) has been reported to be a tumor suppressor gene. However, a number of contrary studies suggested that DAB2 promotes tumor invasion in urothelial carcinoma of the bladder (UCB). Here, we investigated the clinical role and biological function
Mio Nakanishi et al.
Cell, 177(4), 910-924 (2019-04-16)
The assembly of organized colonies is the earliest manifestation in the derivation or induction of pluripotency in vitro. However, the necessity and origin of this assemblance is unknown. Here, we identify human pluripotent founder cells (hPFCs) that initiate, as well as

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico