Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU077471

Sigma-Aldrich

MISSION® esiRNA

targeting human AKT2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGGGCTAAAGTGACCATGAATGACTTCGACTATCTCAAACTCCTTGGCAAGGGAACCTTTGGCAAAGTCATCCTGGTGCGGGAGAAGGCCACTGGCCGCTACTACGCCATGAAGATCCTGCGGAAGGAAGTCATCATTGCCAAGGATGAAGTCGCTCACACAGTCACCGAGAGCCGGGTCCTCCAGAACACCAGGCACCCGTTCCTCACTGCGCTGAAGTATGCCTTCCAGACCCACGACCGCCTGTGCTTTGTGATGGAGTATGCCAACGGGGGTGAGCTGTTCTTCCACCTGTCCCGGGAGCGTGTCTTCACAGAGGAGCGGGCCCGGTTTTATGGTGCAGAGATTGTCTCGGCTCTTGAGTACTTGCACTCGCGGGACGTGGTATACCGCGACATCAAGCTGGAAAACCTCATGCTGGACAAAGATGGCCACATCAAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wanmu Xie et al.
Journal of thrombosis and thrombolysis, 50(1), 98-111 (2020-05-03)
Venous thromboembolism (VTE) carries a high risk of morbidity and mortality. Understanding the mechanisms of venous thrombus formation and resolution is critical for improving VTE management. AKT2 kinase is essential for platelet activation and arterial thrombosis. In this study, we
Mohammad Imran Khan et al.
Molecular cancer therapeutics, 18(2), 356-363 (2018-11-18)
Hyperactivated AKT kinase due to loss of its negative regulator PTEN influences many aspects of cancer biology, including chromatin. AKT primarily regulates acetyl-CoA production and phosphorylates many histone-modulating enzymes, resulting in their activation or inhibition. Therefore, understanding the therapeutic impact
Yong Cui et al.
OncoTargets and therapy, 8, 1681-1690 (2015-07-18)
The AKT2 kinase (protein kinase Bβ) is overexpressed in high-grade gliomas. Upregulation of the AKT2 gene has been previously observed in glioblastoma patients suffering from chemotherapy failure and tumor progress. In this study, we aimed to evaluate the effect of
Yang Sun et al.
PloS one, 10(4), e0119783-e0119783 (2015-04-10)
Aberrant microRNA (miRNA) expression is associated with tumor development. This study aimed to elucidate the role of miR-615-5p in the development of pancreatic ductal adenocarcinoma (PDAC). Locked nucleic acid in situ hybridization (LNA-ISH) was performed to compare miR-615-5p expression in
Dineo Khabele et al.
Journal of Cancer, 5(8), 670-678 (2014-09-27)
Overexpression of the epidermal growth factor receptor (EGFR) is associated with the malignant phenotype in many cancers including ovarian cancer, which leads to increased cell proliferation and survival. In spite of emerging EGFR inhibitors as a potentially useful agent, they

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico