Skip to Content
Merck
All Photos(1)

Key Documents

EMU090241

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hdac3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTGGTAGAAGAGGCCATTAGTGAGGAACTTCCCTATAGTGAATACTTCGAGTACTTTGCCCCAGATTTCACACTCCATCCAGATGTCAGCACCCGCATCGAGAATCAGAACTCACGCCAGTATCTGGACCAGATCCGCCAGACAATCTTTGAAAACTTGAAGATGCTGAACCATGCACCCAGTGTCCAGATTCATGATGTCCCGGCAGACCTCCTGACGTATGACAGGACTGACGAGGCCGACGCTGAAGAGAGAGGTCCCGAGGAGAACTACAGCAGGCCAGAAGCACCCAATGAGTTCTATGATGGCGACCATGACAACGACAAGGAAAGTTGATGTGGAGATTTAGAGCAGCATGGATGCTGTGTCCCAAGAGTTCCTTGTCACCTCTGTGGTGGGAAGGAAAGTATGGTTTCCCCAGGTCTGAACTGGGTACCCCCAGGGTGTTTACTAACTCTGGTGAAGGGTTTGGAAACCATATGTGGTTCTAGAATTAACTCCCTTTCCTCAAACTCTCACGGCCTGATGATTGTCCCTCTCAGGGATGAGACATGGACA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Olga S Safronova et al.
Nucleic acids research, 42(14), 8954-8969 (2014-07-25)
Hypoxia is associated with a variety of physiological and pathological conditions and elicits specific transcriptional responses. The elongation competence of RNA Polymerase II is regulated by the positive transcription elongation factor b (P-TEFb)-dependent phosphorylation of Ser2 residues on its C-terminal
S S Roy et al.
Oncogene, 33(28), 3707-3716 (2013-08-27)
Tumor metastasis is the leading cause of death among breast cancer patients. PELP1 (proline, glutamic acid and leucine rich protein 1) is a nuclear receptor coregulator that is upregulated during breast cancer progression to metastasis and is an independent prognostic
Takuya Yashiro et al.
PloS one, 10(9), e0137699-e0137699 (2015-09-12)
The transcription factor PU.1 is predominantly expressed in dendritic cells (DCs) and is essential for DC differentiation. Although there are several reports that PU.1 positively regulates the expression of DC-specific genes, whether PU.1 also has a suppressive effect on DCs

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service