Skip to Content
Merck
All Photos(1)

Key Documents

EHU111271

Sigma-Aldrich

MISSION® esiRNA

targeting human HNRNPA1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAAGCCCTGTCAAAGCAAGAGATGGCTAGTGCTTCATCCAGCCAAAGAGGTCGAAGTGGTTCTGGAAACTTTGGTGGTGGTCGTGGAGGTGGTTTCGGTGGGAATGACAACTTCGGTCGTGGAGGAAACTTCAGTGGTCGTGGTGGCTTTGGTGGCAGCCGTGGTGGTGGTGGATATGGTGGCAGTGGGGATGGCTATAATGGATTTGGTAATGATGGTGGTTATGGAGGAGGCGGCCCTGGTTACTCTGGAGGAAGCAGAGGCTATGGAAGTGGTGGACAGGGTTATGGAAACCAGGGCAGTGGCTATGGCGGGAGTGGCAGCTATGACAGCTATAACAACGGAGGCGGAGGCGGCTTTGGCGGTGGTAGTGGTAGCAATTTTGGAGGTGGTGGAAGCTAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Cheng-Kai Chang et al.
PloS one, 12(11), e0188214-e0188214 (2017-11-18)
The viral ribonucleoprotein (vRNP) of influenza A virus is formed by virion RNA (vRNA), viral polymerase complex, and nucleoprotein (NP). The NP plays an important role in facilitating the replication and stabilization of viral RNA. To explore host factors that
Mariana D Mandler et al.
Nucleic acids research, 42(11), 7319-7329 (2014-05-06)
The selective RNA-binding protein quaking I (QKI) plays important roles in controlling alternative splicing (AS). Three QKI isoforms are broadly expressed, which display distinct nuclear-cytoplasmic distribution. However, molecular mechanisms by which QKI isoforms control AS, especially in distinct cell types
Mei-Ling Li et al.
Methods (San Diego, Calif.), 183, 13-20 (2020-02-23)
Enterovirus A71 (EV-A711) RNA contains an internal ribosomal entry site (IRES) to direct cap-independent translation. IRES-dependent translation requires the host's translation initiation factors and IRES-associated trans-acting factors (ITAFs). We previously showed that hnRNP A1, the mRNA stability factor HuR, and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service