Skip to Content
Merck
All Photos(1)

Key Documents

EHU051131

Sigma-Aldrich

MISSION® esiRNA

targeting human TGFBR1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAAGTCATCACCTGGCCTTGGTCCTGTGGAACTGGCAGCTGTCATTGCTGGACCAGTGTGCTTCGTCTGCATCTCACTCATGTTGATGGTCTATATCTGCCACAACCGCACTGTCATTCACCATCGAGTGCCAAATGAAGAGGACCCTTCATTAGATCGCCCTTTTATTTCAGAGGGTACTACGTTGAAAGACTTAATTTATGATATGACAACGTCAGGTTCTGGCTCAGGTTTACCATTGCTTGTTCAGAGAACAATTGCGAGAACTATTGTGTTACAAGAAAGCATTGGCAAAGGTCGATTTGGAGAAGTTTGGAGAGGAAAGTGGCGGGGAGAAGAAGTTGCTGTTAAGATATTCTCCTCTAGAGAAGAACGTTCGTGGTTCCGTGAGGCAGAGATTT

Ensembl | human accession no.

ENSG00000106799

NCBI accession no.

NM_004612

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TGFBR1(7046) , TGFBR1(7046)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Weitang Liao et al.
Frontiers in physiology, 11, 1093-1093 (2020-10-06)
Renal tubulointerstitial fibrosis is usually the final outcome of various end-stage renal diseases. Recent studies have reported that microRNAs (miRNAs) play an important role in renal fibrosis. However, the biological function of microRNAs in renal fibrosis is complicated and remains
Hilène Lin et al.
Scientific reports, 8(1), 10488-10488 (2018-07-12)
Cartilage loss in osteoarthritis (OA) results from altered local production of growth factors and metalloproteases (MMPs). Furin, an enzyme involved in the protein maturation of MMPs, might regulate chondrocyte function. Here, we tested the effect of furin on chondrocyte catabolism
Lincan Duan et al.
PloS one, 13(7), e0200452-e0200452 (2018-07-12)
In the tumor progression, transforming growth factor β1 (TGFβ1) plays a critical role in tumorigenesis as well as metastasis. It is known that high plasma level of TGFβ1 in patients with advanced non-small cell lung cancer (NSCLC) is correlated with
Kaushal Asrani et al.
The Journal of clinical investigation, 127(11), 4001-4017 (2017-09-26)
Despite its central position in oncogenic intracellular signaling networks, the role of mTORC1 in epithelial development has not been studied extensively in vivo. Here, we have used the epidermis as a model system to elucidate the cellular effects and signaling
Si-Rui Ma et al.
Oncotarget, 6(11), 8807-8821 (2015-04-15)
Anterior gradient protein 2 (AGR2) is a novel biomarker with potential oncogenic role. We sought to investigate the diagnostic and prognostic role of AGR2 on head and neck squamous cell carcinoma (HNSCC) with an emphasis on its correlation of cancer

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service