콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EMU090571

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Dnmt1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GAACCCCAGATGTTGACCAGTGAGAAACTGTCCATCTACGACTCCACCTCGACCTGGTTTGATACTTATGAAGATTCTCCCATGCATAGGTTCACTTCCTTCAGTGTGTACTGCAGTCGCGGGCACCTGTGTCCTGTCGACACCGGTCTCATTGAGAAGAATGTAGAGCTCTACTTTTCTGGGTGTGCCAAAGCAATTCATGACGAGAATCCATCTATGGAAGGTGGTATTAATGGCAAAAACCTCGGGCCAATCAATCAGTGGTGGCTCAGTGGCTTTGATGGTGGCGAGAAGGTGCTCATTGGCTTCTCCACTGCATTTGCTGAATACATTTTGATGGAGCCCAGCAAAGAGTATGAGCCAATATTTGGGCTGATGCAGGAGAAAATTTACATCAGCAAGATTGTTGTTGAGTTCCTGCAAAACAATCCTGATGCTGTATATGAAGACCTGATCAATAAGATTGAGACCACTGTTCCTCCTTCTACCATTAATGTGAACCGGTTCACAGAGGACTCCCTCTTACGCCACGCCCAGTTTGTAGTGAGCCAGGTAGAGAGTTACGACGAAGCCAAGG

Ensembl | 마우스 수납 번호

ENSMUSG00000004099

NCBI 수납 번호

NM_010066

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... DNMT1(13433) , Dnmt1(13433)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Sichen Li et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(22), 5808-5822 (2014-09-17)
IDH1/2-mutant gliomas harbor a distinct glioma-CpG island methylation phenotype (G-CIMP) that may promote the initiation and progression of secondary pathway gliomas by silencing tumor-suppressive genes. The potential role of tumor-suppressive microRNAs (miRNA; miR) in this process is not understood. To
A K Mitra et al.
Oncogene, 34(48), 5923-5932 (2015-03-24)
The cross-talk between ovarian cancer (OvCa) cells and the metastatic microenvironment is an essential determinant of successful colonization. MicroRNAs (miRNAs) have several critical roles during metastasis; however, the role of microenvironmental cues in the regulation of miRNAs in metastasizing cancer
Kanwalat Chalertpet et al.
Cancer science, 106(10), 1333-1340 (2015-08-08)
Human papillomavirus (HPV) oncoproteins drive distinctive promoter methylation patterns in cancer. However, the underlying mechanism remains to be elucidated. Cyclin A1 (CCNA1) promoter methylation is strongly associated with HPV-associated cancer. CCNA1 methylation is found in HPV-associated cervical cancers, as well
Hui Zhang et al.
Theriogenology, 84(6), 846-852 (2015-07-22)
RNA interference is an important tool to study the gene function. Microinjection and electroporation are usually used to transfer DNA, small interference RNA (siRNA), morpholinos, and protein into oocytes or embryos. This study used a simple and effective method to

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.