설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCTTCCAGTGTGCTGTCAAAAAGGTACGACTCGAGGTGTTTCGGGTAGAGGAACTAGTGGCCTGTGCTGGTCTGAGCTCGCCCAGAATCGTCCCTCTCTATGGAGCTGTGAGAGAAGGCCCGTGGGTGAACATCTTCATGGAACTGCTAGAAGGTGGCTCGCTGGGTCAGCTCATAAAGCAAATGGGCTGTCTGCCAGAAGACCGAGCCCTTTACTACCTGGGCCAGGCCCTGGAGGGGCTGGAGTACCTCCACACACGCAGGATTCTGCATGGCGATGTCAAAGCTGACAACGTGCTCCTGTCCAGTGATGGAAGCCGAGCGGCCCTCTGCGACTTTGGCCACGCCTTGTGCCTGCAACCTGACGGCCTAGGGAAATCCTTGCTCACAGGGGACTACATTCCTGGCACGGAG
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... MAP3K14(53859) , Map3k14(53859)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
British journal of haematology, 167(3), 376-384 (2014-08-01)
Overexpression of the apoptosis repressor with caspase recruitment domain (ARC, also termed NOL3) protein predicts adverse outcome in patients with acute myeloid leukaemia (AML) and confers drug resistance to AML cells. The second mitochondrial-derived activator of caspases (SMAC, also termed
Journal of immunology (Baltimore, Md. : 1950), 195(6), 2829-2841 (2015-08-19)
Pharmacological stimulation of the antiviral cytokine IFN-β in the airways may help to counter deleterious virus-induced exacerbations in chronic inflammatory lung diseases (asthma, chronic obstructive pulmonary disease, or cystic fibrosis). Polyinosinic-polycytidylic acid [poly(I:C)] is a known inducer of IFN-β but
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.