콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EMU056071

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mavs

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TAGGAAGCCCTGAGCCACTAGCCACCCAGCAGCCCCAAGAAGAGGAAGAACATTGTGCCAGTTCAATGCCCTGGGCTAAGTGGCTTGGGGCCACCAGTGCACTCTTGGCTGTATTCCTGGCAGTGATGCTGTACCGTAGTAGGCGCCTGGCCCAGTGAAGCCTCAGCTGTATGCTGTTCTCTTGCTCAGTTCTGCCAAGCATGTTCTCTAGGCTTGGGCTAGTAGAGGCTGAGTCAGAGAAACTTAAATATGGCGAGGTCCACTGAGCTATCCAGGTAGATAGCTACACCAAGACGTCATCACTGTTGGGTGGGGGAGAGACATTGTTTTATCCTGGTTCATATGTCATCTTCTGGTCTTCAGCTTTTGGAGGCACTGTGTTACCTCCATTGCTCCTGACCTGCCCACGTGGCAGTGTAAGAGTTCATGCTCTGTGCTCCTAAGGAGGTATCTCCACCAGCTTTATCCCTGTTGGCCCAAGCCTGAAGATGAGGAG

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Pradip B Devhare et al.
PloS one, 8(5), e63793-e63793 (2013-05-15)
Hepatitis E virus (HEV) is a major cause of enterically transmitted acute hepatitis in developing nations and occurs in sporadic and epidemic forms. The disease may become severe with high mortality (20%) among pregnant women. Due to lack of efficient
Charlotte Odendall et al.
Nature immunology, 15(8), 717-726 (2014-06-24)
Type I interferon responses are considered the primary means by which viral infections are controlled in mammals. Despite this view, several pathogens activate antiviral responses in the absence of type I interferons. The mechanisms controlling type I interferon-independent responses are
Huachen Gan et al.
Scientific reports, 5, 17916-17916 (2015-12-09)
Influenza A virus (IAV) targets airway epithelial cells and exploits the host cell machinery to replicate, causing respiratory illness in annual epidemics and pandemics of variable severity. The high rate of antigenic drift (viral mutation) and the putative antigenic shift

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.