추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGACTCCTTCCCAGGACAACTAGGTAGAAACAGAGGGCCTAAGGTGAACACTGTGCCTCCATTAGATAGTATGCAGCCTGGTGTCTGTCAGCAAAGTGTTCCTGTAAGTGATAAGTATCTTGAAATAAAAAAGCAGGAGGGTGAGGCTGTCTGTGCAGACTTCTCTCCATGTCTATTCTCAGACCATCTTGAGCAATCTATGAGTGGTAAGGTTTTTCAGGTTTGCTCTGAGACACCTGATGACCTGCTGGATGATGTTGAAATACAGGGACATACTAGCTTTGGTGAAGGTGACATAATGGAGAGATCTGCTGTCTTTAACGGAAGCATCCTGAGAAGGGAGTCCAGTAGGAGCCCTAGTCCTGTAACCCATGCATCGAAGTCTCAGAGTCTCCACAGAGCGTCTAGGAA
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... BRCA1(12189) , Brca1(12189)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
BMC cancer, 15, 817-817 (2015-10-30)
Impairment of homologous recombination (HR) is found in close to 50 % of ovarian and breast cancer. Tumors with BRCA1 mutations show increased expression of the Insulin-like growth factor type 1 receptor (IGF-1R). We previously have shown that inhibition of
Cancer letters, 369(1), 184-191 (2015-08-25)
Breast and lung cancer patients who are treated with radiotherapy often have severe side effects, including radiation-induced lung damage and secondary cancers. Activation of the NRF2 pathway is a well-known mechanism that protects cells against radiation induced oxidative stress, but
The EMBO journal, 33(15), 1698-1712 (2014-06-27)
Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for
PloS one, 9(8), e103819-e103819 (2014-08-02)
Fifteen percent of tumors utilize recombination-based alternative lengthening of telomeres (ALT) to maintain telomeres. The mechanisms underlying ALT are unclear but involve several proteins involved in homologous recombination including the BLM helicase, mutated in Bloom's syndrome, and the BRCA1 tumor
Molecular oncology, 9(7), 1259-1273 (2015-04-07)
Risk factors indicate the importance of oxidative stress during ovarian carcinogenesis. To tolerate oxidative stress, cells activate the transcription factor Nrf2 (Nfe2l2), the master regulator of antioxidant and cytoprotective genes. Indeed, for most cancers, hyperactivity of Nrf2 is observed, and
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.