콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU044441

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ppargc1a

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AACAAGCACTTCGGTCATCCCTGTCAAGCTGTGTTTGACGACAAATCAGACAAGACCAGTGAACTAAGGGATGGCGACTTCAGTAATGAACAATTCTCCAAACTACCTGTGTTTATAAATTCAGGACTAGCCATGGATGGCCTATTTGATGACAGTGAAGATGAAAGTGATAAACTGAGCTACCCTTGGGATGGCACGCAGCCCTATTCATTGTTCGATGTGTCGCCTTCTTGCTCTTCCTTTAACTCTCCGTGTCGAGACTCAGTGTCACCACCGAAATCCTTATTTTCTCAAAGACCCCAAAGGATGCGCTCTCGTTCAAGATCCTTTTCTCGACACAGGTCGTGTTCCCGATCACCATATTCCAGGTCAAGATCAAGGTCCCCAGGCAGTAGATCCTCTTCAAGATCCTGTTACTACTATGAATCAAGCCACTACAGACACCGCACACACCGCAATTCTCCCTTGTATGTGAGATCACGTTCAAGGTCACCCTACAGCCGTAGGCCCAGGTACGACAGCTATGAAGCCTATGAGCACGAAAGGCTCAAGAGGGATGAATACCGC

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

생화학적/생리학적 작용

Ppargc1a (peroxisome proliferator-activated receptor γ coactivator 1-α) is a transcriptional co-activator. It is down-regulated in prostate cancer and is linked with disease progression. It plays an important role in mitochondrial function and biogenesis. Changes in the methylation pattern of the gene promoter causes changes in the mitochondrial DNA content. It controls endothelial homeostasis by participating in endothelial nitric oxide (NO) synthase (eNOS) activity and NO production. It plays an important role in insulin signaling. It is responsible for the activation of gluconeogenesis in hepatocytes, regulating thermogenesis in brown adipose tissue, fatty acid oxidation in the heart. It also controls reactive oxygen species production.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Epigenetic regulation of an adverse metabolic phenotype in polycystic ovary syndrome: the impact of the leukocyte methylation of PPARGC1A promoter.
Zhao H
Fertility and Sterility, 107, 467-467 (2017)
PGC-1a ameliorates AngiotensinII-induced eNOS dysfunction in human aortic endothelial cells.
Li J
Vascular Pharmacology, 83, 90-90 (2016)
Lack of direct evidence for natural selection at the candidate thrifty gene locus, PPARGC1A.
Cadzow M
BMC Medical Genetics, 17, 80-80 (2016)
Suppression of endothelial PGC-1a is associated with hypoxia-induced endothelial dysfunction and provides a new therapeutic target in pulmonary arterial hypertension.
Ye JX
American Journal of Physiology. Lung Cellular and Molecular Physiology, 310, L1233-L1233 (2016)
The metabolic co-regulator PGC1a suppresses prostate cancer metastasis.
Torrano V, et. al.
Nature Cell Biology, 18, 645-645 (2016)

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.