콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU031691

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Casp8

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGCAAATGAAATCCACGAGATTCTAGAAGGCTACCAAAGCGCAGACCACAAGAACAAAGACTGCTTCATCTGCTGTATCCTATCCCACGGTGACAAGGGTGTCGTCTATGGAACGGATGGGAAGGAGGCCTCCATCTATGACCTGACATCTTACTTCACTGGTTCAAAGTGCCCTTCCCTGTCTGGGAAACCCAAGATCTTTTTCATTCAGGCTTGCCAAGGAAGTAACTTCCAGAAAGGAGTGCCTGATGAGGCAGGCTTCGAGCAACAGAACCACACTTTAGAAGTGGATTCATCATCTCACAAGAACTATATTCCGGATGAGGCAGACTTTCTGCTGGGAATGGCTACGGTGAAGAACTGCGTTTCCTACCGAGATCCTGTGAATGGAACCTGGTATATTCAGTCACTTTGCCAGAGCCTGAGGGAAAGATGTCCTCAAGGAGATGACATTCTTAGCATCCTGACTGGCGT

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

R Coriat et al.
Cell death & disease, 2, e191-e191 (2011-08-13)
Organotellurides are newly described redox-catalyst molecules with original pro-oxidative properties. We have investigated the in vitro and in vivo antitumoral effects of the organotelluride catalyst LAB027 in a mouse model of colon cancer and determined its profile of toxicity in
Meng Yu et al.
Molecular carcinogenesis, 53(7), 505-513 (2013-01-30)
Activation of telomerase is a key element in oncogenesis and resistance to apoptosis for many cancers. Some histone deacetylase inhibitors (HDACi) or chemotheraputic agents have been reported to downregulate the expression of human telomerase reverse transcriptase (hTERT). However, whether hTERT
René Weiss et al.
Antiviral research, 123, 93-104 (2015-09-15)
New anti-viral agents and strategies are urgently needed to fight rapidly mutating viruses, as vaccine programs cannot react fast enough to prevent pandemics. Recently, we have shown that interleukin-24 (IL-24) sensitizes tumor cells to toll-like receptor 3 (TLR3) mediated apoptosis.
Kei-Ichi Ishikawa et al.
PloS one, 9(4), e94645-e94645 (2014-04-12)
Mutations in p150glued cause hereditary motor neuropathy with vocal cord paralysis (HMN7B) and Perry syndrome (PS). Here we show that both overexpression of p150glued mutants and knockdown of endogenous p150glued induce apoptosis. Overexpression of a p150glued plasmid containing either a

Global Trade Item Number

SKUGTIN
EMU031691-20UG4061828485567
EMU031691-50UG4061828260270

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.