콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU028861

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdkn1c

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TTTAGAGGCTAACGGCCAGAGAGAACTTGCTGGGCATCTGGGCAGCGGACGATGGAAGAACTCTGGGCTTCGGCTGGGACCTTTCGTTCATGTAGCAGGAACCGGAGATGGTTGCGTAGAGCAGCCCACGGTTTTGTGGAAATCTGAAAACTGTGCAATGTATTGAGAACACTCTGTACCATGTGCAAGGAGTACGCTGGTCCCAAGGTGTAAAGCTTTAAATCATTTATGTAAAATGTTTAATCTCTACTCGCTCTCAGTGCAAAACAAAAAGAGAAACTAGAAAATGTAGAACGAAGGAAAAAGATGAGAAAAAGGAAAAAGCATGTATATTTGTACAAAAAGTTAAAAAATTATGCTAATTTAATATTTGTATTTATCCATGCGTGGATCCCTCTGCCACGCAACTGCTGGGTTATTGATTATTACCAAAGGCACTAGAAATCACCAGCTTCAGATTACCCA

Ensembl | 마우스 수납 번호

ENSMUSG00000037664

NCBI 수납 번호

NM_009876

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... CDKN1C(12577) , Cdkn1c(12577)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
XWR
AOR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

H M Coley et al.
British journal of cancer, 106(3), 482-489 (2012-01-12)
Carboplatin remains a first-line agent in the management of epithelial ovarian cancer (EOC). Unfortunately, platinum-resistant disease ultimately occurs in most patients. Using a novel EOC cell line with acquired resistance to carboplatin: PEO1CarbR, genome-wide micro-array profiling identified the cyclin-dependent kinase
Elizabeth M Algar et al.
PloS one, 4(2), e4482-e4482 (2009-02-18)
SMARCB1 is deleted in rhabdoid tumor, an aggressive paediatric malignancy affecting the kidney and CNS. We hypothesized that the oncogenic pathway in rhabdoid tumors involved epigenetic silencing of key cell cycle regulators as a consequence of altered chromatin-remodelling, attributable to
Hui Guo et al.
BMC gastroenterology, 15, 104-104 (2015-08-15)
Our previous research suggested that p57 downregulation could accelerate the growth and invasion of hepatocellular carcinoma in vitro and in vivo. To evaluate the role of cytoplasmic p57 and its regulatory mechanism during hepatocellular carcinoma invasion. We examined the subcellular
Jihong Zhang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 71, 7-14 (2015-05-12)
MicroRNAs (miRNA) have oncogenic or tumor-suppressive roles in the development and growth of human glioma. Glioma development is also associated with alteration in the activities and expression of cell cycle regulators, and miRNAs are emerging as important regulators of cell

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.