설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGGGCCAACAGAACAGAAGAAAATGTTTCAGACGGTTCCCCGAACGCTGGCACTGTGGAGCAGACGCCCAAGAAGCCCGGCCTTCGACGCCAGACGTAAACAGCTCCGGTGGGTTAATGAGGAAGAACACAAAACTGACACCCCATCTGGGCTGCGCTCCCCGGGGGGCCTGCAGACCCCAGGACTGCTGGCAGATTAGTTGCCTGCCAGGAGGAATTACTTTCCTTGATCAAAAAAATTAACACTGGGGAAGGCTGGAATCACTTGAGGGGACTATAATGCAGTATTTGCACCCCAAGATATTTACCTTAAAGTGGAATCAGAATGAGGTTCCCAAGCAAGAACTTGCCACCAAGGCCCCAAAGGATAGGGACGGTCGTATCCTTATGAATCCCACTAAAACTTAGGCTGGGAATGACAGTTTTCCTTTCCAGTCTCAGTTCATGAGAACCCATTTCCCAGAG
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... CDKN1B(12576) , Cdkn1b(12576)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Abedul Haque et al.
Apoptosis : an international journal on programmed cell death, 20(7), 986-995 (2015-04-11)
Combinatorial approaches using two or more compounds are gaining increasing attention for cancer therapy. We have previously reported that the combination of the EGFR-TKI erlotinib and epigallocatechin-3-gallate (EGCG) exhibited synergistic chemopreventive effects in head and neck cancers by inducing the
Juan Qin et al.
Oncotarget, 6(9), 6944-6958 (2015-03-10)
Side population (SP) contains cancer stem-like cells (CSLCs). In this study, we characterized SP cells from nasopharyngeal carcinoma (NPC) cell lines and found that SP cells had a higher self-renewal ability in vitro and greater tumorigenicity in vivo. The AKT
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.