추천 제품
설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TTCCTGCATCCAATGTTTACCTACAGTATATGAGAAATGGAGAGCTTCCAGCTGAACAGGCTATTCCGGTCTGTGGTTCACCACCTACAATTAATGCTGGTTTTGAATTACTTGTAGCATTAGCTGTTGGCTGTGTGAGGAATCTCAAACAAATAGTAGATTCTTTGACTGAAATGTATTACATTGGCACAGCAATAACTACTTGTGAAGCACTTACTGAGTGGGAATATCTGCCACCTGTTGGACCCCGCCCACCCAAAGGATTCGTGGGGCTGAAAAATGCCGGTGCTACTTGTTACATGAATTCTGTGATTCAGCAACTCTACATGATTCCTTCCATTAGGAACGGTATTCTTGCCATTGAAGGCACAGGTAGTGATGTAGATGATGATATGTCTGGGGATGAGAAGCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... USP9X(8239) , USP9X(8239)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Hui Peng et al.
The Journal of reproduction and development, 64(2), 173-177 (2018-02-13)
Fas-associated protein factor 1 (FAF1) is a Fas-associated protein that functions in multiple cellular processes. Previous research showed that mutations in Faf1 led to the lethality of cleavage stage embryos in a mouse model. The aim of the present study
Hua He et al.
ACS nano, 10(2), 1859-1870 (2016-01-27)
Treatment of inflammatory diseases represents one of the biggest clinical challenges. RNA interference (RNAi) against TNF-α provides a promising modality toward anti-inflammation therapy, but its therapeutic potential is greatly hampered by the by the lack of efficient siRNA delivery vehicles
Yu Xia et al.
International journal of nanomedicine, 13, 143-159 (2018-01-11)
Human homeobox protein (Nanog) is highly expressed in most cancer cells and has gradually emerged as an excellent target in cancer therapy, owing to its regulation of cancer cell proliferation, metastasis and apoptosis. In this study, we prepared tumor-targeting functionalized
Gang Chen et al.
ACS nano, 12(7), 6620-6636 (2018-07-10)
Metastatic breast cancer is a major cause of cancer-related female mortality worldwide. The signal transducer and activator of transcription 3 (STAT3) and the chemokine receptor CXCR4 are involved in the metastatic spread of breast cancer. The goal of this study
Context-dependent function of the deubiquitinating enzyme USP9X in pancreatic ductal adenocarcinoma.
Jesse L Cox et al.
Cancer biology & therapy, 15(8), 1042-1052 (2014-05-21)
Pancreatic ductal adenocarcinoma (PDAC) is one of the most aggressive and deadly malignancies. Recently, the deubiquitinating protease USP9X has been shown to behave as an oncogene in a number of neoplasms, including those of breast, brain, colon, esophagus and lung
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.