설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACTCGCCAGAAGATTGGAGAAGAGGCTATGTTTAATCCTCAACTCATGATACAGACCCCTAAAGAAGAAGGTGCTAATGTCCTGACCACAGAAGCGCTCCTACAACACCTGGACTCGGCACTCCAGGCCAGCCGTGTCCATGTATACATGTACAACAGGCAGTGGAAATTGGAACATTTGTGTTACAAATCAGGAGAGCTTATCACAGAAACAGGTTACATGGATCAGATAATAGAATATCTTTACCCTTGTTTGATTATTACACCTTTGGACTGCTTCTGGGAAGGGGCGAAATTACAGTCTGGGACAGCATACCTCCTAGGTAAACCTCCTTTGCGGTGGACAAACTTCGACCCTTTGGAATTCCTGGAAGAGTTAAAGAAAATAAACTATCAAGTGGACAGCTGGGAG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... PTCH1(5727) , PTCH1(5727)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Yingying Hong et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 31(7), 1413-1428 (2016-02-19)
Nevoid basal cell carcinoma syndrome (NBCCS) is an autosomal dominant disorder characterized by bone and skin abnormalities and a predisposition to various tumors. Keratocystic odontogenic tumors (KCOTs), which are common tumors of the jaw that cause extensive damage to the
Xuechao Wan et al.
Oncotarget, 9(4), 4798-4813 (2018-02-13)
Metastasis is the most common cause of mortality for non-small cell lung cancer (NSCLC). PTCH1, a receptor of Hedgehog (Hh) pathway, is reported to suppress cell proliferation. Interestingly, our previous study showed PTCH1 silencing promoted cell proliferation but inhibited cell
A Tam et al.
Scientific reports, 9(1), 3353-3353 (2019-03-06)
Genome-wide association studies have linked gene variants of the receptor patched homolog 1 (PTCH1) with chronic obstructive pulmonary disease (COPD). However, its biological role in the disease is unclear. Our objective was to determine the expression pattern and biological role
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.