추천 제품
설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CAACTTTGACAACCCCGTCTATCAGAAGACCACAGAGGATGAGGTCCACATTTGCCACAACCAGGACGGCTACAGCTACCCCTCGAGACAGATGGTCAGTCTGGAGGATGACGTGGCGTGAACATCTGCCTGGAGTCCCGTCCCTGCCCAGAACCCTTCCTGAGACCTCGCCGGCCTTGTTTTATTCAAAGACAGAGAAGACCAAAGCATTGCCTGCCAGAGCTTTGTTTTATATATTTATTCATCTGGGAGGCAGAACAGGCTTCGGACAGTGCCCATGCAATGGCTTGGGTTGGGATTTTGGTTTCTTCCTTTCCTCGTGAAGGATAAGAGAAACAGGCCCGGGGGGACCAGGATGACACCTCCATTTCTCTCCAGGAAGTTTTGAGTTTCTCTCCACCGTGACACAATCCTCAAACATGGAAGATGAAAGGGGAGGGGATGTCAGGCCCAGAGAAGCAAGTGGCTTTCAACACACAACAGCAGATGGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... LDLR(3949) , LDLR(3949)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Xue-Hai Liang et al.
Nucleic acids research, 45(16), 9528-9546 (2017-09-22)
A variety of diseases are caused by deficiencies in amounts or activity of key proteins. An approach that increases the amount of a specific protein might be of therapeutic benefit. We reasoned that translation could be specifically enhanced using trans-acting
E J Gallagher et al.
Oncogene, 36(46), 6462-6471 (2017-08-02)
Obesity is associated with an increase in cancer-specific mortality in women with breast cancer. Elevated cholesterol, particularly low-density lipoprotein cholesterol (LDL-C), is frequently seen in obese women. Here, we aimed to determine the importance of elevated circulating LDL, and LDL
Kentaro Gokita et al.
Molecular therapy. Nucleic acids, 19, 330-338 (2019-12-27)
MicroRNAs (miRNAs) are endogenous small noncoding RNAs that negatively regulate gene expression by interfering with the translation or stability of target transcripts. Some tumor-suppressive miRNAs can concurrently target multiple cancer-promoting genes and may be useful as therapeutic anticancer agents. However
Jinkuk Choi et al.
Science translational medicine, 7(314), 314ra184-314ra184 (2015-11-20)
Apolipoprotein E (ApoE) is an important modifier of Alzheimer's disease (AD) pathogenesis, and its abundance has been linked to the clearance of β-amyloid (Aβ) in the brain. The pathways that control the clearance of ApoE in the brain are incompletely
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.