추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGTGGGATGGAACAGGACAGGAGGTGGTAGTGGATACCAGTTTGGAGAGCCCAGCTGGCCTGGCCATTGATTGGGTCACCAACAAACTGTACTGGACAGATGCAGGTACAGACCGGATTGAAGTAGCCAACACAGATGGCAGCATGAGAACAGTACTCATCTGGGAGAACCTTGATCGTCCTCGGGACATCGTGGTGGAACCCATGGGCGGGTACATGTATTGGACTGACTGGGGTGCGAGCCCCAAGATTGAACGAGCTGGCATGGATGCCTCAGGCCGCCAAGTCATTATCTCTTCTAATCTGACCTGGCCTAATGGGTTAGCTATTGATTATGGGTCCCAGCGTCTATACTGGGCTGACGCCGGCATGAAGACAATTGAATTTGCTGGACTGGATGGCAGTAAGAGGAAGGTGCTGATTGGAA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... LRP4(4038) , LRP4(4038)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Mdig promotes oncogenic gene expression through antagonizing repressive histone methylation markers.
Theranostics, 10(2), 602-614 (2020-01-07)
The mineral dust-induced gene (mdig) is overexpressed in a number of human cancers, suggesting critical roles of this gene played on the pathogenesis of cancers. Unlike several other JmjC-domain containing proteins that exhibit histone demethylase activity, it remains enigmatic whether
Biochemical and biophysical research communications, 503(1), 257-263 (2018-06-11)
Dysregulation of cell proliferation and death is considered the foundation of the malignant biological characteristics of cancer. In this study, we conducted a comprehensive analysis of a massively parallel whole transcriptome resequencing of paired papillary thyroid cancer and normal thyroid
Scientific reports, 6, 36305-36305 (2016-11-12)
Several epidemiological studies suggested an increased incidence rate of multiple myeloma (MM) among first responders and other individuals who exposed to World Trade Center (WTC) dust. In this report, we provided evidence showing that WTC dust is potent in inducing
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.