콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU152091

Sigma-Aldrich

MISSION® esiRNA

targeting human CASP8

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TCCAAATGCAAACTGGATGATGACATGAACCTGCTGGATATTTTCATAGAGATGGAGAAGAGGGTCATCCTGGGAGAAGGAAAGTTGGACATCCTGAAAAGAGTCTGTGCCCAAATCAACAAGAGCCTGCTGAAGATAATCAACGACTATGAAGAATTCAGCAAAGAGAGAAGCAGCAGCCTTGAAGGAAGTCCTGATGAATTTTCAAATGACTTTGGACAAAGTTTACCAAATGAAAAGCAAACCTCGGGGATACTGTCTGATCATCAACAATCACAATTTTGCAAAAGCACGGGAGAAAGTGCCCAAACTTCACAGCATTAGGGACAGGAATGGAACACACTTGGATGCAGGGGCTTTGACCACGACCTTTGAAGAGCTTCATTTTGAGATCAAGCCCC

Ensembl | 인체 수납 번호

ENSG00000064012

NCBI 수납 번호

NM_001080124

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... CASP8(841) , CASP8(841)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
ZRU
WRU
LET

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Bin Xu et al.
Oncology research, 25(7), 1161-1168 (2017-01-22)
Currently, multiple microRNAs (miRNAs) have been found to play vital roles in the pathogenesis of osteosarcoma. This study aimed to investigate the role of miR-21 in osteosarcoma. The level of miR-21 in 20 pairs of osteosarcoma and corresponding adjacent tissues
Biswajit Podder et al.
Cell death and differentiation, 26(12), 2520-2534 (2019-03-10)
Melanoma cells are highly resistant to conventional genotoxic agents, and BRAFV600/MEK-targeted therapies as well as immunotherapies frequently remain inefficient. Alternative means to treat melanoma, in particular through the induction of programmed cell death modalities such as apoptosis or necroptosis, therefore
Jong-Heon Won et al.
Molecules (Basel, Switzerland), 23(12) (2018-12-16)
The natural product 23-hydroxyursolic acid (23-HUA) is a derivative of ursolic acid, which is known to induce cancer cell apoptosis. However, apoptotic effects and mechanisms of 23-HUA have not been well characterized yet. Herein, we investigated the molecular mechanisms of
Bang-Chuan Hu et al.
Theranostics, 10(25), 11479-11496 (2020-10-15)
Tubular damage initiated by inflammatory response and ischemic/hypoxic stress is a hallmark of septic acute kidney injury (AKI), albeit the molecular mechanism coupling the two events remains unclear. We investigated the intrinsic nature of tubular damage with respect to inflammatory/hypoxic
Nyree Crawford et al.
Cell death and differentiation, 25(11), 1952-1966 (2018-03-04)
Apoptosis resistance contributes to treatment failure in colorectal cancer (CRC). New treatments that reinstate apoptosis competency have potential to improve patient outcome but require predictive biomarkers to target them to responsive patient populations. Inhibitor of apoptosis proteins (IAPs) suppress apoptosis
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.