콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU151861

Sigma-Aldrich

MISSION® esiRNA

targeting human VIM

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCTTGAACGCAAAGTGGAATCTTTGCAAGAAGAGATTGCCTTTTTGAAGAAACTCCACGAAGAGGAAATCCAGGAGCTGCAGGCTCAGATTCAGGAACAGCATGTCCAAATCGATGTGGATGTTTCCAAGCCTGACCTCACGGCTGCCCTGCGTGACGTACGTCAGCAATATGAAAGTGTGGCTGCCAAGAACCTGCAGGAGGCAGAAGAATGGTACAAATCCAAGTTTGCTGACCTCTCTGAGGCTGCCAACCGGAACAATGACGCCCTGCGCCAGGCAAAGCAGGAGTCCACTGAGTACCGGAGACAGGTGCAGTCCCTCACCTGTGAAGTGGATGCCCTTAAAGGAACCAATGAGTCCCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCCGTTGAAGC

Ensembl | 인체 수납 번호

ENSG00000026025

NCBI 수납 번호

NM_003380

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... VIM(7431) , VIM(7431)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Wei Wu et al.
Virology, 497, 41-52 (2016-07-17)
Influenza A virus exploits the subcellular transport machinery during the early stages of infection. Actin filaments and microtubules facilitate the trafficking of virus-containing endosomes towards the perinuclear region; however, the role of vimentin remains to be determined. In this study
Yue Peng et al.
Life sciences, 249, 117503-117503 (2020-03-07)
To investigate the role and mechanism of insulin-like growth factor 1(IGF-1)-mediated EMT on multiple myeloma (MM) growth and metastasis. The expression data from GEO datasets were utilized to explore the expression levels of IGF-1 and epithelial-mesenchymal transition (EMT) markers in
Shih-Hung Chan et al.
Oncotarget, 8(25), 41364-41378 (2017-05-11)
The association between metabolic diseases and the risk of developing cancer is emerging. However, the impact of long pentraxin-3 (PTX3) on dyslipidemia-associated tumor metastasis remains unknown. In this study, we found that oleate induced PTX3 expression and secretion through the
Fu Jun Li et al.
American journal of physiology. Lung cellular and molecular physiology, 313(1), L80-L91 (2017-04-30)
Exposure to cadmium (Cd) has been associated with development of chronic obstructive lung disease (COPD). The mechanisms and signaling pathways whereby Cd causes pathological peribronchiolar fibrosis, airway remodeling, and subsequent airflow obstruction remain unclear. We aimed to evaluate whether low-dose
Brian Koons et al.
ACS nano, 11(12), 12037-12048 (2017-11-17)
Cell migration is studied with the traditional focus on protrusion-driven cell body displacement, while less is known on morphodynamics of individual protrusions themselves, especially in fibrous environments mimicking extracellular matrix. Here, using suspended fibers, we report integrative and multiscale abilities
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.