콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU151281

Sigma-Aldrich

MISSION® esiRNA

targeting human PCSK6 (2)

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GGCCCCAAATTATGATTCCTACGCCAGCTACGACGTGAACGGCAATGATTATGACCCATCTCCACGATATGATGCCAGCAATGAAAATAAACACGGCACTCGTTGTGCGGGAGAAGTTGCTGCTTCAGCAAACAATTCCTACTGCATCGTGGGCATAGCGTACAATGCCAAAATAGGAGGCATCCGCATGCTGGACGGCGATGTCACAGATGTGGTCGAGGCAAAGTCGCTGGGCATCAGACCCAACTACATCGACATTTACAGTGCCAGCTGGGGGCCGGACGACGACGGCAAGACGGTGGACGGGCCCGGCCGACTGGCTAAGCAGGCTTTCGAGTATGGCATTAAAAAGGGCCGGCAGGGCCTGGGCTCCATTTTCGTCTGGGCATCTGGGAATGGCGGGAGAGAGGGGGACTACTGCTCGTGCGATGGCTACACCAACAGCATCTACACCATCTCCGTCAGCAGCGCCACCGAGAATGGCTACAAGCCCTGGTACCTGGAAGAGTGTGCCTCCACCCTGGCCACCACCTACAGCAGTGGGGCCTTTTATGAGCGAAAAATCGTCACC

Ensembl | 인체 수납 번호

ENSG00000140479

NCBI 수납 번호

NM_002570

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... PCSK6(5046) , PCSK6(5046)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xiao-Feng Tian et al.
Molecular medicine reports, 14(6), 5205-5210 (2016-10-26)
Previous studies have demonstrated the overexpression of paired basic amino acid cleaving enzyme 4 (PACE4) mRNA in prostate cancer tissues. This overexpression is correlated with higher circulating protein levels in certain patients, however, the role of PACE4 in apoptosis and the
Jian Fu et al.
Molecular carcinogenesis, 54(9), 698-706 (2014-01-18)
Proprotein convertases (PC), a family of serine proteases, process cancer-related substrates such as growth factors, growth factor receptors, cell adhesion molecules, metalloproteinases, etc. HIF-1α is a major transcription factor involved in tumorigenesis by sensing intratumoral hypoxia. Furin (PCSK3) is one
Zhiyong Yao et al.
Drug design, development and therapy, 9, 5911-5923 (2015-11-26)
PACE4 is a proprotein convertase capable of processing numerous substrates involved in tumor growth, invasion, and metastasis. However, the precise role of PACE4 during prostate cancer cell apoptosis has not been reported. In the present study, human prostate cancer cell
Huiyu Jiang et al.
Molecular medicine reports, 12(5), 7681-7686 (2015-10-16)
The aim of the present study was to assess the effects of pro-protein convertase subtilisin/kexin type 6 (PCSK6), a proteinase implicated in the proteolytic activity of various precursor proteins and involved in the regulation of protein maturation, in fibroblast‑like synoviocytes

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.