추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TACCACAGCAAGGTCAACCAGTGTACCCAATCACGACAGGAGGATTCAGACACCCCTACCCCACAGCTCTGACCGTCAATGCTTCCATGTCCAGGTTCCCTCCCCATATGGTCCCACCACATCATACGCTACACACGACGGGCATTCCGCATCCGGCCATAGTCACACCAACAGTCAAACAGGAATCGTCCCAGAGTGATGTCGGCTCACTCCATAGTTCAAAGCATCAGGACTCCAAAAAGGAAGAAGAAAAGAAGAAGCCCCACATAAAGAAACCTCTTAATGCATTCATGTTGTATATGAAGGAAATGAGAGCAAAGGTCGTAGCTGAGTGCACGTTGAAAGAAAGCGCGGCCATCAACCAGATCCTTGGGCGGAGGTGGCATGCACTGTCCAGAGAAGAGCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TCF7L2(6934) , TCF7L2(6934)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Jia Cui et al.
Aging, 12(2), 1591-1609 (2020-01-24)
Islet β cell mass reduction induced by glucose fluctuation is crucial for the development and progression of T2DM. Chikusetsu saponin IVa (CHS) had protective effects against DM and related injuries. Here we aimed to investigate the role of CHS in
J Wang et al.
British journal of cancer, 111(1), 112-124 (2014-05-31)
Invasion and metastasis remain a critical issue in cervical cancer. However, the underlying mechanism of it in cervical cancer remains unclear. The newly discovered protein, TBLR1, plays a crucial role in regulating various key cellular functions. In this study, western
Chong Chen et al.
Cancer research, 75(8), 1725-1735 (2015-03-07)
Considerable evidence suggests that proinflammatory pathways drive self-renewal of cancer stem-like cells (CSC), but the underlying mechanisms remain mainly undefined. Here we report that the let7 repressor LIN28B and its regulator IKBKB (IKKβ) sustain cancer cell stemness by interacting with
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.