콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU134001

Sigma-Aldrich

MISSION® esiRNA

targeting human TCF7L2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TACCACAGCAAGGTCAACCAGTGTACCCAATCACGACAGGAGGATTCAGACACCCCTACCCCACAGCTCTGACCGTCAATGCTTCCATGTCCAGGTTCCCTCCCCATATGGTCCCACCACATCATACGCTACACACGACGGGCATTCCGCATCCGGCCATAGTCACACCAACAGTCAAACAGGAATCGTCCCAGAGTGATGTCGGCTCACTCCATAGTTCAAAGCATCAGGACTCCAAAAAGGAAGAAGAAAAGAAGAAGCCCCACATAAAGAAACCTCTTAATGCATTCATGTTGTATATGAAGGAAATGAGAGCAAAGGTCGTAGCTGAGTGCACGTTGAAAGAAAGCGCGGCCATCAACCAGATCCTTGGGCGGAGGTGGCATGCACTGTCCAGAGAAGAGCA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jia Cui et al.
Aging, 12(2), 1591-1609 (2020-01-24)
Islet β cell mass reduction induced by glucose fluctuation is crucial for the development and progression of T2DM. Chikusetsu saponin IVa (CHS) had protective effects against DM and related injuries. Here we aimed to investigate the role of CHS in
J Wang et al.
British journal of cancer, 111(1), 112-124 (2014-05-31)
Invasion and metastasis remain a critical issue in cervical cancer. However, the underlying mechanism of it in cervical cancer remains unclear. The newly discovered protein, TBLR1, plays a crucial role in regulating various key cellular functions. In this study, western
Chong Chen et al.
Cancer research, 75(8), 1725-1735 (2015-03-07)
Considerable evidence suggests that proinflammatory pathways drive self-renewal of cancer stem-like cells (CSC), but the underlying mechanisms remain mainly undefined. Here we report that the let7 repressor LIN28B and its regulator IKBKB (IKKβ) sustain cancer cell stemness by interacting with

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.