콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU131091

Sigma-Aldrich

MISSION® esiRNA

targeting human KL

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AGAATGACCGACCACAGCATCAAAGAATGTCAAAAATCTCTGGACTTTGTACTAGGTTGGTTTGCCAAACCCGTATTTATTGATGGTGACTATCCCGAGAGCATGAAGAATAACCTTTCATCTATTCTGCCTGATTTTACTGAATCTGAGAAAAAGTTCATCAAAGGAACTGCTGACTTTTTTGCTCTTTGCTTTGGACCCACCTTGAGTTTTCAACTTTTGGACCCTCACATGAAGTTCCGCCAATTGGAATCTCCCAACCTGAGGCAACTGCTTTCCTGGATTGACCTTGAATTTAACCATCCTCAAATATTTATTGTGGAAAATGGCTGGTTTGTCTCAGGGACCACCAAGAGAGATGATGCCAAATATATGTATTACCTCAAAAAGTTCATCATGGAAACCTTAAAAGCCATCAAGCTGGATGGGGTGGATGTCATCGGGTATACCGCATGGTCCCTCATGGATGGTTTCGAGT

Ensembl | 인체 수납 번호

ENSG00000133116

NCBI 수납 번호

NM_004795

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... KL(9365) , KL(9365)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Lin Chen et al.
PloS one, 8(3), e58413-e58413 (2013-03-22)
Klotho was originally characterized as an aging suppressor gene that predisposed Klotho-deficient mice to premature aging-like syndrome. Although Klotho was recently reported to exhibit tumor suppressive properties during various malignant transformations, the functional role and molecular mechanism of Klotho in
Xiaowei Tang et al.
Laboratory investigation; a journal of technical methods and pathology, 96(2), 197-205 (2015-08-04)
Klotho, an anti-aging gene, has recently been shown to contribute to human hepatic tumorigenesis. In addition, it is known that Wnt signaling is antagonized by the protein klotho. Because augmented Wnt signaling has an important role in tumorigenesis of human
Youliang Yan et al.
Molecular medicine reports, 15(4), 1777-1785 (2017-03-06)
Klotho is a recently discovered anti‑aging gene, which has been reported as a tumor suppressor in numerous human malignancies; however, the role of Klotho in human ovarian cancer remains to be elucidated. The aim of the present study was to
Jinpeng Hu et al.
Experimental and therapeutic medicine, 21(5), 486-486 (2021-04-02)
Early reperfusion is the most effective and important treatment for acute myocardial infarction. However, reperfusion therapy often leads to a certain degree of myocardial damage. The aim of the present study was to identify the role of klotho, and the
Lina Xing et al.
Life sciences, 269, 119068-119068 (2021-01-22)
Podocyte apoptosis plays an important role in the pathogenesis of diabetic nephropathy (DN). Astragaloside IV (AS-IV) has been shown to protect against podocyte apoptosis. Here we aim to investigate the mechanism responsible for the protective effects of AS-IV. Diabetic db/db
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.