콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU129261

Sigma-Aldrich

MISSION® esiRNA

targeting human PAK6, BUB1B-PAK6

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CTGCTGGACAGCTACGTGAAGATTGGCGAGGGCTCCACCGGCATCGTCTGCTTGGCCCGGGAGAAGCACTCGGGCCGCCAGGTGGCCGTCAAGATGATGGACCTCAGGAAGCAGCAGCGCAGGGAGCTGCTCTTCAACGAGGTGGTGATCATGCGGGACTACCAGCACTTCAACGTGGTGGAGATGTACAAGAGCTACCTGGTGGGCGAGGAGCTGTGGGTGCTCATGGAGTTCCTGCAGGGAGGAGCCCTCACAGACATCGTCTCCCAAGTCAGGCTGAATGAGGAGCAGATTGCCACTGTGTGTGAGGCTGTGCTGCAGGCCCTGGCCTACCTGCATGCTCAGGGTGTCATCCACCGGGACATCAAGAGTGACTCCATCCTGCTGACCCTCGATGGCAGGGTGAAGCTCTCGGACTTCGGATTCTGTGCTCAGATCAGCAAAGACGTCCCTAAGAGGAAGTCCCTGGTGGGAACCCCCTACTGGATGGCTCCTGAAGTGATCTCCAGGTCTTTGTATGCCACTGAGGTGGATATCTGGTCTCTGGGCATCATGGTGATTGAGATGGTAGATGGGGAGC

Ensembl | 인체 수납 번호

ENSG00000137843

NCBI 수납 번호

NM_001128628

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... PAK6(106821730) , PAK6(56924)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
JUU
NRR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Daniel Pensold et al.
Cerebral cortex (New York, N.Y. : 1991), 27(12), 5696-5714 (2017-11-09)
The proliferative niches in the subpallium generate a rich cellular variety fated for diverse telencephalic regions. The embryonic preoptic area (POA) represents one of these domains giving rise to the pool of cortical GABAergic interneurons and glial cells, in addition
Sally Fram et al.
Cellular and molecular life sciences : CMLS, 71(14), 2759-2773 (2013-12-20)
p-21 activated 6 (PAK6), first identified as interacting with the androgen receptor (AR), is over-expressed in multiple cancer tissues and has been linked to the progression of prostate cancer, however little is known about PAK6 function in the absence of
Jian Zhai et al.
Biochemical and biophysical research communications, 464(1), 161-167 (2015-06-28)
Emerging evidence suggests that microRNAs (miRNAs) play important roles in regulating HCC development and progression; however, the mechanisms by which their specific functions and mechanisms remained to be further explored. miR-129 has been reported in gastric cancers, lung cancer and
Songwang Cai et al.
Oncotarget, 6(6), 3904-3917 (2015-02-26)
Here we found that levels of miR-23a were decreased in prostate cancer cell lines and tumor tissues. These low levels were associated with poor patients' prognosis. MiR-23a inhibited migration and invasion of prostate cancer in vivo and in orthotopic prostate
Weisi Liu et al.
The Journal of biological chemistry, 290(47), 28489-28501 (2015-10-08)
Our previous studies identified the oncogenic role of p21-activated kinase 1 (PAK1) in hepatocellular carcinoma (HCC) and renal cell carcinoma (RCC). Contrarily, PAK6 was found to predict a favorable prognosis in RCC patients. Nevertheless, the ambiguous tumor suppressive function of

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.