추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GTCTTCTCCCGGGATGTCTCAGGAATTGAGAACAATGACGACCAATAGCTCAGATCCTTTCCTTAACAGTGGCACCTATCACTCTCGAGATGAGAGTACAGACAGTGGACTAAGCATGAGCAGCTACAGTGTCCCTCGAACCCCAGATGACTTCCTGAACAGTGTGGATGAGATGGATACAGGTGATACTATCAACCAAAGCACCCTGCCCTCACAGCAGAACCGTTTCCCAGACTACCTTGAAGCCATTCCTGGGACAAATGTGGACCTTGGAACACTGGAAGGAGATGGAATGAACATAGAAGGAGAGGAGCTGATGCCAAGTCTGCAGGAAGCTTTGAGTTCTGACATCCTTAATGACATGGAGTCTGTTTTGGCTGCCACCAAGCTAGATAAAGAAAGCTTTCTTACATGGTTATAGAGCCCTCAGGCAGACTGAATTCTAAATCTGTGAAGGATCTAAGGAGACACATGCACCGGAAATT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... YAP1(10413) , YAP1(10413)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Pierre-Olivier Guichet et al.
The Journal of pathology, 246(2), 205-216 (2018-07-17)
During the last decade, large-scale genomic analyses have clarified the somatic alterations in gliomas, providing new molecular classification based on IDH1/2 mutations and 1p19q codeletion with more accurate patient prognostication. The Hippo pathway downstream effectors, YAP1 and TAZ, have recently
Marcel Trautmann et al.
EMBO molecular medicine, 11(5) (2019-03-23)
Myxoid liposarcomas (MLS), malignant tumors of adipocyte origin, are driven by the FUS-DDIT3 fusion gene encoding an aberrant transcription factor. The mechanisms whereby FUS-DDIT3 mediates sarcomagenesis are incompletely understood, and strategies to selectively target MLS cells remain elusive. Here we
Wenlong He et al.
Thoracic cancer, 11(3), 549-560 (2020-01-11)
Lung cancer is the leading cause of cancer-related mortality worldwide. Studies have demonstrated that long noncoding RNA nicotinamide nucleotide transhydrogenase-antisense RNA1 (NNT-AS1) functioned as an oncogene in most malignancies, including non-small cell lung cancer (NSCLC). This study aimed to investigate
Akira Takaguri et al.
European journal of pharmacology, 815, 470-477 (2017-09-28)
Apoptosis of vascular smooth muscle cells (VSMCs) has been implicated in the progression of atherosclerosis, especially in vascular remodelling and plaque rupture. Although it is known that Yes-associated protein 1 (YAP1) is a critical molecule that regulates cell proliferation, differentiation
Functional screening identifies miRNAs influencing apoptosis and proliferation in colorectal cancer.
Lise Lotte Christensen et al.
PloS one, 9(6), e96767-e96767 (2014-06-04)
MicroRNAs (miRNAs) play a critical role in many biological processes and are aberrantly expressed in human cancers. Particular miRNAs function either as tumor suppressors or oncogenes and appear to have diagnostic and prognostic significance. Although numerous miRNAs are dys-regulated in
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU113021-50UG | 4061831374858 |
| EHU113021-20UG | 4061831358537 |
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.