콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU098701

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPT

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AAGGTGACCTCCAAGTGTGGCTCATTAGGCAACATCCATCATAAACCAGGAGGTGGCCAGGTGGAAGTAAAATCTGAGAAGCTTGACTTCAAGGACAGAGTCCAGTCGAAGATTGGGTCCCTGGACAATATCACCCACGTCCCTGGCGGAGGAAATAAAAAGATTGAAACCCACAAGCTGACCTTCCGCGAGAACGCCAAAGCCAAGACAGACCACGGGGCGGAGATCGTGTACAAGTCGCCAGTGGTGTCTGGGGACACGTCTCCACGGCATCTCAGCAATGTCTCCTCCACCGGCAGCATCGACATGGTAGACTCGCC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Sheng Yi et al.
Journal of cell science, 132(6) (2019-02-21)
Tau protein (encoded by the gene microtubule-associated protein tau, Mapt) is essential for the assembly and stability of microtubule and the functional maintenance of the nervous system. Tau is highly abundant in neurons and is detectable in astrocytes and oligodendrocytes.
Tomi Rantamäki et al.
PloS one, 8(7), e68722-e68722 (2013-07-12)
Brain-derived neurotrophic factor (BDNF) importantly regulates learning and memory and supports the survival of injured neurons. Reduced BDNF levels have been detected in the brains of Alzheimer's disease (AD) patients but the exact role of BDNF in the pathophysiology of
Varun Balaji et al.
Autophagy, 14(12), 2139-2154 (2018-08-28)
Missorting of MAPT/Tau represents one of the early signs of neurodegeneration in Alzheimer disease. The triggers for this are still a matter of debate. Here we investigated the sorting mechanisms of endogenous MAPT in mature primary neurons using microfluidic chambers

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.