추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGAAATGCCTGGCTCCTATTCGAGACCCCAAGACCGAGCAGGATGGACATGATATTGAGAACGAGTGTCTAGGGATGGCTGTCCTGGCCATCTCACACTATGCCATGATGAAGAAGATGCAGTTGCCAGAACTGCCCAAGGACATCAGCTACAAGCGATATATTCCAGAAACATTGAATAAGTCCATCAGACAGAGGAACCTTCTCACCAGGATGCGGATAAATAATGTTTTCAAGGATTTCCTAAAGGAATTTAACAACAAGACCATTTGTGACAGCAGCGTGTCCACGCATGACCTGAAGGTGAAATACTTGGCTACCTTGGAAACTTTGACAAAACATTACGGTGCTGAAATATTTGAGACTTCCATGTTACTGATTTCATCAGAAAATGAGATGAATTGGTTTCATTCGAATGACGGTGGAAACGTTCTC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... JAK1(3716) , JAK1(3716)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Journal of immunology (Baltimore, Md. : 1950), 197(9), 3695-3704 (2016-09-25)
JAK2 genetic variants are associated with inflammatory bowel disease (IBD) and JAK inhibitors are being evaluated for therapy targeting immune-mediated diseases, including IBD. As JAK pathway-mediated cytokine regulation varies across cell types and stimulation conditions, we examined how JAK signaling
Oncotarget, 8(24), 38113-38135 (2017-05-13)
Human colon cancers express higher levels of NADPH oxidase 1 [NOX1] than adjacent normal epithelium. It has been suggested that reactive oxygen species [ROS] derived from NOX1 contribute to DNA damage and neoplastic transformation in the colon, particularly during chronic
The Journal of clinical investigation, 129(8), 3324-3338 (2019-07-16)
Glycosylation of immune receptors and ligands, such as T cell receptor and coinhibitory molecules, regulates immune signaling activation and immune surveillance. However, how oncogenic signaling initiates glycosylation of coinhibitory molecules to induce immunosuppression remains unclear. Here we show that IL-6-activated
The Journal of biological chemistry, 290(48), 29022-29034 (2015-10-09)
JAK1 and JAK3 are recurrently mutated in acute lymphoblastic leukemia. These tyrosine kinases associate with heterodimeric cytokine receptors such as IL-7 receptor or IL-9 receptor, in which JAK1 is appended to the specific chain, and JAK3 is appended to the
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.