콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU084491

Sigma-Aldrich

MISSION® esiRNA

targeting human CHAF1A

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GCCTGAATCTTGTCCCAAAGGGGAAAGCCGATGACATGTCAGACGATCAGGGTACTTCTGTGCAAAGTAAAAGCCCCGATTTAGAGGCCTCTTTGGACACCTTGGAAAACAACTGTCATGTGGGTTCTGACATAGACTTTAGACCGAAACTTGTCAACGGGAAGGGTCCCTTAGATAACTTTTTAAGAAATAGAATCGAAACCAGTATTGGCCAGAGCACAGTCATCATTGATTTGACAGAGGACTCGAATGAGCAGCCAGACAGTCTTGTGGACCACAATAAACTAAATTCTGAAGCCTCTCCCTCCAGGGAGGCAATAAATGGCCAGCGAGAAGACACTGGGGATCAGCAGGGGTTGTTGAAGGCCATTCAGAACGACAAGTTGGCATTTCCTGGAGAGA

Ensembl | 인체 수납 번호

ENSG00000167670

NCBI 수납 번호

NM_005483

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... CHAF1A(10036) , CHAF1A(10036)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

생화학적/생리학적 작용

CHAF1A (chromatin assembly factor 1 subunit A) is one of the subunits of CAF1 complex, a histone chaperone responsible for the positioning of histone H3 and H4 dimers into nucleosomes. CAF1 is needed for S-phase progression, heterochromatin formation and chromatin restoration after DNA repair. CAF1A is required for promoting protein and chromosome associations with nucleoli. It is required for cell proliferation and is upregulated in colon cancer and aggressive neuroblastoma.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

A separable domain of the p150 subunit of human chromatin assembly factor-1 promotes protein and chromosome associations with nucleoli.
Smith CL, et. al.
Molecular Biology of the Cell, 25, 2866-2866 (2014)
The Chromatin Assembly Factor Complex 1 (CAF1) and 5-Azacytidine (5-AzaC) Affect Cell Motility in Src-transformed Human Epithelial Cells.
Endo A
The Journal of Biological Chemistry, 292, 172-172 (2017)
Regulation of oxidized base damage repair by chromatin assembly factor 1 subunit A.
Yang C
Nucleic Acids Research, 45, 739-739 (2017)
Corey L Smith et al.
Molecular biology of the cell, 25(18), 2866-2881 (2014-07-25)
Chromatin assembly factor-1 (CAF-1) is a three-subunit protein complex conserved throughout eukaryotes that deposits histones during DNA synthesis. Here we present a novel role for the human p150 subunit in regulating nucleolar macromolecular interactions. Acute depletion of p150 causes redistribution

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.