콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU082441

Sigma-Aldrich

MISSION® esiRNA

targeting human DAB2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CTGGGACTTTGAGTGCCTTTGCCAGTTATTTCAACAGCAAGGTTGGCATTCCTCAGGAGAATGCAGACCATGATGACTTTGATGCTAATCAACTATTGAACAAGATCAATGAACCACCAAAGCCAGCTCCCAGACAAGTTTCCCTGCCAGTTACCAAATCTACTGACAATGCATTTGAGAACCCTTTCTTTAAAGATTCTTTTGGTTCATCACAAGCCTCTGTGGCTTCTTCTCAACCTGTATCTTCTGAGATGTATAGGGATCCATTTGGAAATCCTTTTGCCTAAATTCTGAACTTGGTCTGCAGACCATCCAGAGGAATAAAAAGGTTGGCCTTAGTAGTCAAAAACAAAGCTGATAGCCAGACACGTTCTGATTTCTGCCCTTGTTCCAGCTTTGACGT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yuan Cheng et al.
Journal of experimental & clinical cancer research : CR, 35, 11-11 (2016-01-16)
MicroRNA-106b (miR-106b) was recently identified as an oncogene participating in cancer progression. Transforming growth factor β1(TGF-β1) is an indispensable cytokine regulating the local microenvironment, thereby promoting cervical cancer progression. However, the roles of miR-106b in cervical carcinoma progression and TGF-β1-involvement
Yoshitaka Itami et al.
Diagnostics (Basel, Switzerland), 10(1) (2020-01-24)
Disabled homolog-2 (DAB2) has been reported to be a tumor suppressor gene. However, a number of contrary studies suggested that DAB2 promotes tumor invasion in urothelial carcinoma of the bladder (UCB). Here, we investigated the clinical role and biological function
Mio Nakanishi et al.
Cell, 177(4), 910-924 (2019-04-16)
The assembly of organized colonies is the earliest manifestation in the derivation or induction of pluripotency in vitro. However, the necessity and origin of this assemblance is unknown. Here, we identify human pluripotent founder cells (hPFCs) that initiate, as well as

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.