콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU073641

Sigma-Aldrich

MISSION® esiRNA

targeting human ARNTL

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGGAGGGACTCCAGACATTCCTTCCAGTGGCCTACTATCAGGCCAGGCTCAGGAGAACCCAGGTTATCCATATTCTGATAGTTCTTCTATTCTTGGTGAGAACCCCCACATAGGTATAGACATGATTGACAACGACCAAGGATCAAGTAGTCCCAGTAATGATGAGGCAGCAATGGCTGTCATCATGAGCCTCTTGGAAGCAGATGCTGGACTGGGTGGCCCTGTTGACTTTAGTGACTTGCCATGGCCGCTGTAAACACTACATGTTGCTTTGGCAACAGCTATAGTATCAAAGTGCATTACTGGTGGAGTTTTACAGTCTGTGAAGCTTACTGGATAAGGAGAGAATAGCTTTTATGTACTGACTTCATAAAAGCCATCTCAGAGCCATTGATACAAGTCAATCTTACTATATGTAACTTCAGACAAAGTGGAACTAAGCCTGCTCCA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Whitney Sussman et al.
American journal of physiology. Cell physiology, 317(3), C492-C501 (2019-06-20)
The transcription factor aryl hydrocarbon receptor nuclear translocator-like protein-1 (BMAL1) is an essential regulator of the circadian clock, which controls the 24-h cycle of physiological processes such as nutrient absorption. To examine the role of BMAL1 in small intestinal glucose
Panshak P Dakup et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 3347-3358 (2020-01-11)
Radiation therapy (RT) is commonly used to treat solid tumors of the breast, lung, and esophagus; however, the heart is an unintentional target of ionizing radiation (IR). IR exposure to the heart results in chronic toxicities including heart failure. We
Silke Kiessling et al.
BMC biology, 15(1), 13-13 (2017-02-16)
Circadian clocks control cell cycle factors, and circadian disruption promotes cancer. To address whether enhancing circadian rhythmicity in tumor cells affects cell cycle progression and reduces proliferation, we compared growth and cell cycle events of B16 melanoma cells and tumors
Nikolai Genov et al.
Scientific reports, 9(1), 11062-11062 (2019-08-01)
The circadian clock regulates key cellular processes and its dysregulation is associated to several pathologies including cancer. Although the transcriptional regulation of gene expression by the clock machinery is well described, the role of the clock in the regulation of
Rukeia El-Athman et al.
PLoS biology, 15(12), e2002940-e2002940 (2017-12-08)
The mammalian circadian clock and the cell cycle are two major biological oscillators whose coupling influences cell fate decisions. In the present study, we use a model-driven experimental approach to investigate the interplay between clock and cell cycle components and

Global Trade Item Number

SKUGTIN
EHU073641-20UG4061831352931
EHU073641-50UG4061831372830

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.