콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU071991

Sigma-Aldrich

MISSION® esiRNA

targeting human VCP

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGAAGCCATCAATGAGGACAACAGTGTGGTGTCCTTGTCCCAGCCCAAGATGGATGAATTGCAGTTGTTCCGAGGTGACACAGTGTTGCTGAAAGGAAAGAAGAGACGAGAAGCTGTTTGCATCGTCCTTTCTGATGATACTTGTTCTGATGAGAAGATTCGGATGAATAGAGTTGTTCGGAATAACCTTCGTGTACGCCTAGGGGATGTCATCAGCATCCAGCCATGCCCTGATGTGAAGTACGGCAAACGTATCCATGTGCTGCCCATTGATGACACAGTGGAAGGCATTACTGGTAATCTCTTCGAGGTATACCTTAAGCCGTACTTCCTGGAAGCGTATCGACCCATCCGGAAAGGAGACATTTTTCTTGTCCGTGGTGGGATGCGTGCTGTGGAGTTCAAAGTGG

Ensembl | 인체 수납 번호

ENSG00000165280

NCBI 수납 번호

NM_007126

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... VCP(7415) , VCP(7415)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Wallaya Phongphaew et al.
Virus research, 228, 114-123 (2016-12-05)
Valosin-containing protein (VCP) is classified as a member of the type II AAA
Katrin Schweitzer et al.
Journal of cellular and molecular medicine, 20(1), 58-70 (2015-10-16)
Cullin-RING-ubiquitin-ligase (CRL)-dependent ubiquitination of the nuclear factor kappa B (NF-κB) inhibitor IκBα and its subsequent degradation by the proteasome usually precede NF-κB/RelA nuclear activity. Through removal of the CRL-activating modification of their cullin subunit with the ubiquitin (Ub)-like modifier NEDD8
Richard Wargachuk et al.
Cellular signalling, 30, 50-58 (2016-11-27)
GPCRs form signalling complexes with other receptors as part of dimers, G proteins and effector partners. A proteomic screen to identify proteins that associate with the β
Sevil Cayli et al.
Theriogenology, 158, 196-206 (2020-09-24)
p97/valosin-containing protein (VCP) is expressed in many cells and plays critical functions in a broad range of diverse cellular processes. Because it is expressed in the mouse testes, predominantly in Sertoli cells, and is known to play a critical role
Xing Guo et al.
Biochimica et biophysica acta, 1863(2), 552-559 (2016-12-04)
Proteasome-dependent turnover of mitochondrial outer membrane (OMM)-associated proteins is one of the mechanisms for maintaining proper mitochondrial quality and function. However, the underlying pathways and their implications in human disease are poorly understood. Huntington's disease (HD) is a fatal, inherited
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.