콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU067201

Sigma-Aldrich

MISSION® esiRNA

targeting human AKT3

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CAGTGGCAAAATGCCAGTTAATGAAAACAGAACGACCAAAGCCAAACACATTTATAATCAGATGTCTCCAGTGGACTACTGTTATAGAGAGAACATTTCATGTAGATACTCCAGAGGAAAGGGAAGAATGGACAGAAGCTATCCAGGCTGTAGCAGACAGACTGCAGAGGCAAGAAGAGGAGAGAATGAATTGTAGTCCAACTTCACAAATTGATAATATAGGAGAGGAAGAGATGGATGCCTCTACAACCCATCATAAAAGAAAGACAATGAATGATTTTGACTATTTGAAACTACTAGGTAAAGGCACTTTTGGGAAAGTTATTTTGGTTCGAGAGAAGGCAAGTGGAAAATACTATGCTATGAAGATTCTGAAGAAAGAAGTCATTATTGCAAAGGATGAAGTGGCACAC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Guo-Qing Sui et al.
American journal of cancer research, 7(5), 1177-1187 (2017-06-01)
microRNA-338-3p (miR-338-3p) has been implicated in tumor development and progression in many types of cancers. However, the function and mechanism underlying the action of miR-383-3p in thyroid cancer remain unclear and were therefore investigated in this study by
Kohji Noguchi et al.
The Journal of biological chemistry, 292(5), 1910-1924 (2016-12-29)
The suppression of mitotic Aurora kinases (AURKs) by AURK inhibitors frequently causes cytokinetic failure, leading to polyploidy or aneuploidy, indicating the critical role of AURK-mediated phosphorylation during cytokinesis. We demonstrate the deregulated expression of AKT3 in Aurora kinase inhibitor (AURKi)-resistant
Nikolaus A Watson et al.
Nature communications, 11(1), 1684-1684 (2020-04-05)
There are thousands of known cellular phosphorylation sites, but the paucity of ways to identify kinases for particular phosphorylation events remains a major roadblock for understanding kinase signaling. To address this, we here develop a generally applicable method that exploits
Jade Peres et al.
Oncotarget, 6(3), 1821-1833 (2015-01-18)
The AKT3 signalling pathway plays a critical role in melanoma formation and invasion and components of this signalling cascade are therefore attractive targets for the treatment of malignant melanoma. Recent evidence show that the embryonically important TBX3 transcription factor is

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.