추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CAGTGGCAAAATGCCAGTTAATGAAAACAGAACGACCAAAGCCAAACACATTTATAATCAGATGTCTCCAGTGGACTACTGTTATAGAGAGAACATTTCATGTAGATACTCCAGAGGAAAGGGAAGAATGGACAGAAGCTATCCAGGCTGTAGCAGACAGACTGCAGAGGCAAGAAGAGGAGAGAATGAATTGTAGTCCAACTTCACAAATTGATAATATAGGAGAGGAAGAGATGGATGCCTCTACAACCCATCATAAAAGAAAGACAATGAATGATTTTGACTATTTGAAACTACTAGGTAAAGGCACTTTTGGGAAAGTTATTTTGGTTCGAGAGAAGGCAAGTGGAAAATACTATGCTATGAAGATTCTGAAGAAAGAAGTCATTATTGCAAAGGATGAAGTGGCACAC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... AKT3(10000) , AKT3(10000)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
American journal of cancer research, 7(5), 1177-1187 (2017-06-01)
microRNA-338-3p (miR-338-3p) has been implicated in tumor development and progression in many types of cancers. However, the function and mechanism underlying the action of miR-383-3p in thyroid cancer remain unclear and were therefore investigated in this study by
The Journal of biological chemistry, 292(5), 1910-1924 (2016-12-29)
The suppression of mitotic Aurora kinases (AURKs) by AURK inhibitors frequently causes cytokinetic failure, leading to polyploidy or aneuploidy, indicating the critical role of AURK-mediated phosphorylation during cytokinesis. We demonstrate the deregulated expression of AKT3 in Aurora kinase inhibitor (AURKi)-resistant
Nature communications, 11(1), 1684-1684 (2020-04-05)
There are thousands of known cellular phosphorylation sites, but the paucity of ways to identify kinases for particular phosphorylation events remains a major roadblock for understanding kinase signaling. To address this, we here develop a generally applicable method that exploits
Oncotarget, 6(3), 1821-1833 (2015-01-18)
The AKT3 signalling pathway plays a critical role in melanoma formation and invasion and components of this signalling cascade are therefore attractive targets for the treatment of malignant melanoma. Recent evidence show that the embryonically important TBX3 transcription factor is
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.